4glx

DNA ligase A in complex with inhibitor

Method: X-RAY DIFFRACTION

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

DNA ligase

Escherichia coli

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–DNA	Monomer	Protein 1 DNA 3	DNA (26-MER) × 1 ;DNA (5'-D(APCPAPAPTPTPGPCPGPAPCPCPC)-3') ; × 1 ;DNA (5'-D(PCPAPCPTPAPTPCPGPGPAPAPTPG)-3') ; × 1 ZINC ION × 1 SULFATE ION × 1 2-amino-6-bromo-7-(trifluoromethyl)-1,8-naphthyridine-3-carboxamide × 1 water × 4	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	DNLJ_ECOLI
Isoform	—
PDB entities	4
Chains and sequence ranges	Author chain A； PDBConstruct 1–586； UniProt 1–586

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	4glx
Deposition date deposition_date	2012-08-15
Structure title title	DNA ligase A in complex with inhibitor
Keywords keywords	DNA ligase A, inhibitor, LIGASE-LIGASE INHIBITOR-DNA complex; LIGASE/LIGASE INHIBITOR/DNA
Experimental Method method	X-RAY DIFFRACTION

▼

3. Official assembly/model SAXS Official SAXS Profiles

This page reads only the latest assembly calculations. Every curve maps to an explicit PDB entry, official biological assembly and coordinate model.

4glx__assembly_1__model_1

Assembly 1 · Model 1 · CRYSOL 4.1.3-1-20251215 (887e7ef)

Download this curve (.dat)

4glx__assembly_1__model_1 | I(q)

100 plotted points; both axes use logarithmic scales.

4glx__assembly_1__model_1 | P(r) · Pending

P(r) will be calculated and displayed separately for the same assembly/model.

Rg（Guinier）	27.18 Å
Rg (electron density)	26.45 Å
Total Rg	27.16 Å
Atom count	5394
Residues	625
Excluded volume	92235 Å³
Maximum q	0.500 Å⁻¹

Assembly	Model	Structure unit	Oligomeric description	Status	CRYSOL	Actions
1	1	`4glx__assembly_1__model_1`	tetrameric （4）	Success	4.1.3-1-20251215 (887e7ef)	View Download

▶

4. Crystallography and Experiment 4. Crystallography & Experiment

▶

5. Entities and Polymers Entities & Polymers (8)

Entity 1 Entity 1 polymer

Description description	DNA (26-MER)
Molecular weight formula_weight	8034.2 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	B
Atom count atom_count	5637

CATTCCGATAGTGGGGTCGCAATTGT

Entity 2 Entity 2 polymer

Description description	;DNA (5'-D(APCPAPAPTPTPGPCPGPAPCPCP*C)-3') ;
Molecular weight formula_weight	3920.6 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	C

ACAATTGCGACCC

Entity 3 Entity 3 polymer

Description description	;DNA (5'-D(PCPAPCPTPAPTPCPGPGPAPAPTP*G)-3') ;
Molecular weight formula_weight	3975.6 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	D

CACTATCGGAATG

Entity 4 Entity 4 polymer

Description description	DNA ligase
Molecular weight formula_weight	64925.8 kDa
EC 编号 ec_number	6.5.1.2
Source method src_method	man
Copy count entity_count	1

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A

MESIEQQLTELRTTLRHHEYLYHVMDAPEIPDAEYDRLMRELRELETKHPELITPDSPTQRVGAAPLAAFSQIRHEVPMLSLDNVFDEESFLAFNKRVQDRLKNNEKVTWCCELKLDGLAVSILYENGVLVSAATRGDGTTGEDITSNVRTIRAIPLKLHGENIPARLEVRGEVFLPQAGFEKINEDARRTGGKVFANPRNAAAGSLRQLDPRITAKRPLTFFCYGVGVLEGGELPDTHLGRLLQFKKWGLPVSDRVTLCESAEEVLAFYHKVEEDRPTLGFDIDGVVIKVNSLAQQEQLGFVARAPRWAVAFKFPAQEQMTFVRDVEFQVGRTGAITPVARLEPVHVAGVLVSNATLHNADEIERLGLRIGDKVVIRRAGDVIPQVVNVVLSERPEDTREVVFPTHCPVCGSDVERVEGEAVARCTGGLICGAQRKESLKHFVSRRAMDVDGMGDKIIDQLVEKEYVHTPADLFKLTAGKLTGLERMGPKSAQNVVNALEKAKETTFARFLYALGIREVGEATAAGLAAYFGTLEALEAASIEELQKVPDVGIVVASHVHNFFAEESNRNVISELLAEGVHWPAP

Source Source

Source organism organism	Escherichia coli
NCBI taxonomy ID ncbi_taxonomy_id	83333
Host organism host_organism	Escherichia coli

Entity 5 Entity 5 non-polymer

Description description	ZINC ION
Molecular weight formula_weight	65.4 kDa
Source method src_method	syn
Copy count entity_count	1

Entity 6 Entity 6 non-polymer

Description description	SULFATE ION
Molecular weight formula_weight	96.1 kDa
Source method src_method	syn
Copy count entity_count	1

Entity 7 Entity 7 non-polymer

Description description	2-amino-6-bromo-7-(trifluoromethyl)-1,8-naphthyridine-3-carboxamide
Molecular weight formula_weight	335.1 kDa
Source method src_method	syn
Copy count entity_count	1

Entity 8 Entity 8 water

Description description	water
Molecular weight formula_weight	18.0 kDa
Source method src_method	nat
Copy count entity_count	204

▼

6. Fold Classification (SCOP + CATH) 7 domains

CATH v4.4 (7 domains)

Domain ID domain_id	4glxA01
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	287 — Helix Hairpins
Homologous superfamily homologous superfamily	610 — Helix hairpin bin

Domain ID domain_id	4glxA02
Class class	3 — Alpha Beta
Architecture architecture	30 — 2-Layer Sandwich
Topology topology	470 — D-amino Acid Aminotransferase; Chain A, domain 1
Homologous superfamily homologous superfamily	30 — DNA ligase/mRNA capping enzyme

Domain ID domain_id	4glxA03
Class class	3 — Alpha Beta
Architecture architecture	30 — 2-Layer Sandwich
Topology topology	1490 — Dna Ligase; domain 1
Homologous superfamily homologous superfamily	70 —

Domain ID domain_id	4glxA04
Class class	2 — Mainly Beta
Architecture architecture	40 — Beta Barrel
Topology topology	50 — OB fold (Dihydrolipoamide Acetyltransferase, E2P)
Homologous superfamily homologous superfamily	140 — Nucleic acid-binding proteins

Domain ID domain_id	4glxA05
Class class	6 — Special
Architecture architecture	20 — Other non-globular
Topology topology	10 — Laminin
Homologous superfamily homologous superfamily	30 —

Domain ID domain_id	4glxA06
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	150 — DNA polymerase; domain 1
Homologous superfamily homologous superfamily	20 — 5' to 3' exonuclease, C-terminal subdomain

Domain ID domain_id	4glxA07
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	150 — DNA polymerase; domain 1
Homologous superfamily homologous superfamily	20 — 5' to 3' exonuclease, C-terminal subdomain

▶

Unit-cell length a length_a	110.990 Å
Unit-cell length b length_b	100.140 Å
Unit-cell length c length_c	86.570 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	105.50 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	4

Space group space_group	C 1 2 1
Space-group number int_tables_number	5
Crystal system crystal_system	—

Resolution resolution	1.900 Å
Low-resolution limit resolution_low	19.730 Å
R factor r_factor	0.2032
R_work r_work	0.2007
R_free r_free	0.2497

DNA ligase A in complex with inhibitor

1. Protein Identity and Related Structures Protein Identity & Related Structures

DNA ligase

State in the Current Structure

Other States of the Same Protein in the Database

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

4glx__assembly_1__model_1

4glx__assembly_1__model_1 | I(q)

4glx__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (8)

Entity 1 Entity 1 polymer

Polymer Polymer

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 polymer

Polymer Polymer

Entity 4 Entity 4 polymer

Polymer Polymer

Source Source

Entity 5 Entity 5 non-polymer

Entity 6 Entity 6 non-polymer

Entity 7 Entity 7 non-polymer

Entity 8 Entity 8 water

6. Fold Classification (SCOP + CATH) 7 domains

CATH v4.4 (7 domains)

7. Citations (1)

DNA ligase A in complex with inhibitor

1. Protein Identity and Related Structures Protein Identity & Related Structures

DNA ligase

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

4glx__assembly_1__model_1

4glx__assembly_1__model_1 | I(q)

4glx__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (8)

Entity 1 Entity 1 polymer

Polymer Polymer

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 polymer

Polymer Polymer

Entity 4 Entity 4 polymer

Polymer Polymer

Source Source

Entity 5 Entity 5 non-polymer

Entity 6 Entity 6 non-polymer

Entity 7 Entity 7 non-polymer

Entity 8 Entity 8 water

6. Fold Classification (SCOP + CATH) 7 domains

CATH v4.4 (7 domains)

7. Citations (1)