SAXSdb — 4kpy

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

Uncharacterized protein

Thermus thermophilus

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–DNA	Monomer	Protein 1 DNA 3	;DNA (5'-D(PTPGPAPGPGPTPAPGPTPAPGPGPTPTPGPTPAPTPAPGPT)-3') ; × 1 ;DNA (5'-D(PTPAPCPTPAPCPCPTPCPG)-3') ; × 1 ;DNA (5'-D(TPAPTPAPCPAPAPCPC)-3') ; × 1 THYMIDINE-5'-PHOSPHATE × 1 MANGANESE (II) ION × 3 water × 3	Consistent with all polymers
2	Protein–DNA	Monomer	Protein 1 DNA 3	;DNA (5'-D(PTPGPAPGPGPTPAPGPTPAPGPGPTPTPGPTPAPTPAPGPT)-3') ; × 1 ;DNA (5'-D(PTPAPCPTPAPCPCPTPCPG)-3') ; × 1 ;DNA (5'-D(TPAPTPAPCPAPAPCPC)-3') ; × 1 THYMIDINE-5'-PHOSPHATE × 1 MANGANESE (II) ION × 3 water × 4	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	Q746M7_THET2
Isoform	—
PDB entities	1
Chains and sequence ranges	Author chain A； PDBConstruct 1–685； UniProt 1–685 Author chain B； PDBConstruct 1–685； UniProt 1–685

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	4kpy
Deposition date deposition_date	2013-05-14
Structure title title	DNA binding protein and DNA complex structure
Keywords keywords	Argonaute, RNA interference, DNA interference, DNA BINDING PROTEIN-DNA complex; DNA BINDING PROTEIN/DNA
Experimental Method method	X-RAY DIFFRACTION

▼

3. Official assembly/model SAXS Official SAXS Profiles

This page reads only the latest assembly calculations. Every curve maps to an explicit PDB entry, official biological assembly and coordinate model.

4kpy__assembly_1__model_1

Assembly 1 · Model 1 · CRYSOL 4.1.3-1-20251215 (887e7ef)

Download this curve (.dat)

4kpy__assembly_1__model_1 | I(q)

100 plotted points; both axes use logarithmic scales.

4kpy__assembly_1__model_1 | P(r) · Pending

P(r) will be calculated and displayed separately for the same assembly/model.

Rg（Guinier）	28.31 Å
Rg (electron density)	28.08 Å
Total Rg	28.66 Å
Atom count	5957
Residues	708
Excluded volume	104100 Å³
Maximum q	0.500 Å⁻¹

Assembly	Model	Structure unit	Oligomeric description	Status	CRYSOL	Actions
1	1	`4kpy__assembly_1__model_1`	tetrameric （4）	Success	4.1.3-1-20251215 (887e7ef)	View Download
2	1	`4kpy__assembly_2__model_1`	tetrameric （4）	Success	4.1.3-1-20251215 (887e7ef)	View Download

▶

4. Crystallography and Experiment 4. Crystallography & Experiment

▶

5. Entities and Polymers Entities & Polymers (7)

Entity 1 Entity 1 polymer

Description description	Uncharacterized protein
Molecular weight formula_weight	76728.7 kDa
Source method src_method	man
Copy count entity_count	2

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A,B
Atom count atom_count	12268

MNHLGKTEVFLNRFALRPLNPEELRPWRLEVVLDPPPGREEVYPLLAQVARRAGGVTVRMGDGLASWSPPEVLVLEGTLARMGQTYAYRLYPKGRRPLDPKDPGERSVLSALARRLLQERLRRLEGVWVEGLAVYRREHARGPGWRVLGGAVLDLWVSDSGAFLLEVDPAYRILCEMSLEAWLAQGHPLPKRVRNAYDRRTWELLRLGEEDPKELPLPGGLSLLDYHASKGRLQGREGGRVAWVADPKDPRKPIPHLTGLLVPVLTLEDLHEEEGSLALSLPWEERRRRTREIASWIGRRLGLGTPEAVRAQAYRLSIPKLMGRRAVSKPADALRVGFYRAQETALALLRLDGAQGWPEFLRRALLRAFGASGASLRLHTLHAHPSQGLAFREALRKAKEEGVQAVLVLTPPMAWEDRNRLKALLLREGLPSQILNVPLREEERHRWENALLGLLAKAGLQVVALSGAYPAELAVGFDAGGRESFRFGGAACAVGGDGGHLLWTLPEAQAGERIPQEVVWDLLEETLWAFRRKAGRLPSRVLLLRDGRVPQDEFALALEALAREGIAYDLVSVRKSGGGRVYPVQGRLADGLYVPLEDKTFLLLTVHRDFRGTPRPLKLVHEAGDTPLEALAHQIFHLTRLYPASGFAFPRLPAPLHLADRLVKEVGRLGIRHLKEVDREKLFFV

Source Source

Source organism organism	Thermus thermophilus
NCBI taxonomy ID ncbi_taxonomy_id	262724
Host organism host_organism	Escherichia coli

Entity 2 Entity 2 polymer

Description description	;DNA (5'-D(PTPGPAPGPGPTPAPGPTPAPGPGPTPTPGPTPAPTPAPGP*T)-3') ;
Molecular weight formula_weight	6588.3 kDa
Source method src_method	syn
Copy count entity_count	2

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	C,E

TGAGGTAGTAGGTTGTATAGT

Entity 3 Entity 3 polymer

Description description	;DNA (5'-D(PTPAPCPTPAPCPCPTPCPG)-3') ;
Molecular weight formula_weight	2980.0 kDa
Source method src_method	syn
Copy count entity_count	2

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	D,F

TACTACCTCG

Entity 4 Entity 4 polymer

Description description	;DNA (5'-D(TPAPTPAPCPAPAPCP*C)-3') ;
Molecular weight formula_weight	2683.8 kDa
Source method src_method	syn
Copy count entity_count	2

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	M,N

TATACAACC

Entity 5 Entity 5 non-polymer

Description description	THYMIDINE-5'-PHOSPHATE
Molecular weight formula_weight	322.2 kDa
Source method src_method	syn
Copy count entity_count	2

Entity 6 Entity 6 non-polymer

Description description	MANGANESE (II) ION
Molecular weight formula_weight	54.9 kDa
Source method src_method	syn
Copy count entity_count	6

Entity 7 Entity 7 water

Description description	water
Molecular weight formula_weight	18.0 kDa
Source method src_method	nat
Copy count entity_count	356

▼

6. Fold Classification (SCOP + CATH) 8 domains

CATH v4.4 (8 domains)

Domain ID domain_id	4kpyA01
Class class	3 — Alpha Beta
Architecture architecture	30 — 2-Layer Sandwich
Topology topology	530 — Alpha-D-Glucose-1,6-Bisphosphate; Chain A, domain 4
Homologous superfamily homologous superfamily	60 —

Domain ID domain_id	4kpyA02
Class class	3 — Alpha Beta
Architecture architecture	30 — 2-Layer Sandwich
Topology topology	70 — Alpha-Beta Plaits
Homologous superfamily homologous superfamily	2620 —

Domain ID domain_id	4kpyA04
Class class	3 — Alpha Beta
Architecture architecture	30 — 2-Layer Sandwich
Topology topology	420 — Nucleotidyltransferase; domain 5
Homologous superfamily homologous superfamily	10 — Ribonuclease H-like superfamily/Ribonuclease H

Domain ID domain_id	4kpyA05
Class class	3 — Alpha Beta
Architecture architecture	40 — 3-Layer(aba) Sandwich
Topology topology	50 — Rossmann fold
Homologous superfamily homologous superfamily	2300 — Response regulator

Domain ID domain_id	4kpyB01
Class class	3 — Alpha Beta
Architecture architecture	30 — 2-Layer Sandwich
Topology topology	530 — Alpha-D-Glucose-1,6-Bisphosphate; Chain A, domain 4
Homologous superfamily homologous superfamily	60 —

Domain ID domain_id	4kpyB02
Class class	3 — Alpha Beta
Architecture architecture	30 — 2-Layer Sandwich
Topology topology	70 — Alpha-Beta Plaits
Homologous superfamily homologous superfamily	2620 —

Domain ID domain_id	4kpyB04
Class class	3 — Alpha Beta
Architecture architecture	30 — 2-Layer Sandwich
Topology topology	420 — Nucleotidyltransferase; domain 5
Homologous superfamily homologous superfamily	10 — Ribonuclease H-like superfamily/Ribonuclease H

Domain ID domain_id	4kpyB05
Class class	3 — Alpha Beta
Architecture architecture	40 — 3-Layer(aba) Sandwich
Topology topology	50 — Rossmann fold
Homologous superfamily homologous superfamily	2300 — Response regulator

▶

Unit-cell length a length_a	111.329 Å
Unit-cell length b length_b	118.362 Å
Unit-cell length c length_c	160.873 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	90.00 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	8

Space group space_group	P 21 21 21
Space-group number int_tables_number	19
Crystal system crystal_system	—

Resolution resolution	2.406 Å
Low-resolution limit resolution_low	48.312 Å
R factor r_factor	0.1926
R_work r_work	0.1904
R_free r_free	0.2350

DNA binding protein and DNA complex structure

1. Protein Identity and Related Structures Protein Identity & Related Structures

Uncharacterized protein

State in the Current Structure

Other States of the Same Protein in the Database

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

4kpy__assembly_1__model_1

4kpy__assembly_1__model_1 | I(q)

4kpy__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (7)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 polymer

Polymer Polymer

Entity 4 Entity 4 polymer

Polymer Polymer

Entity 5 Entity 5 non-polymer

Entity 6 Entity 6 non-polymer

Entity 7 Entity 7 water

6. Fold Classification (SCOP + CATH) 8 domains

CATH v4.4 (8 domains)

7. Citations (1)

DNA binding protein and DNA complex structure

1. Protein Identity and Related Structures Protein Identity & Related Structures

Uncharacterized protein

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

4kpy__assembly_1__model_1

4kpy__assembly_1__model_1 | I(q)

4kpy__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (7)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 polymer

Polymer Polymer

Entity 4 Entity 4 polymer

Polymer Polymer

Entity 5 Entity 5 non-polymer

Entity 6 Entity 6 non-polymer

Entity 7 Entity 7 water

6. Fold Classification (SCOP + CATH) 8 domains

CATH v4.4 (8 domains)

7. Citations (1)