SAXSdb — 4q5v

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

DNA polymerase alpha catalytic subunit

Homo sapiens

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Other combination	Monomer	Protein 1 DNA 1 RNA 1	RNA primer × 1 DNA template × 1 (3R,4R,4aR,6aS,8R,9R,11aS,11bS)-4,9-bis(hydroxymethyl)-4,11b-dimethyltetradecahydro-8,11a-methanocyclohepta[a]naphthale ne-3,9-diol × 1 water × 3	Consistent with all polymers
2	Other combination	Monomer	Protein 1 DNA 1 RNA 1	RNA primer × 1 DNA template × 1 (3R,4R,4aR,6aS,8R,9R,11aS,11bS)-4,9-bis(hydroxymethyl)-4,11b-dimethyltetradecahydro-8,11a-methanocyclohepta[a]naphthale ne-3,9-diol × 1 water × 3	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	DPOLA_HUMAN
Isoform	—
PDB entities	1
Chains and sequence ranges	Author chain A； PDBConstruct 1–922； UniProt 336–1257 Author chain E； PDBConstruct 1–922； UniProt 336–1257

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	4q5v
Deposition date deposition_date	2014-04-17
Structure title title	Crystal structure of the catalytic core of human DNA polymerase alpha in ternary complex with an RNA-primed DNA template and aphidicolin
Keywords keywords	B-family DNA polymerase, DNA replication, TRANSFERASE-DNA-RNA complex; TRANSFERASE/DNA/RNA
Experimental Method method	X-RAY DIFFRACTION

▼

3. Official assembly/model SAXS Official SAXS Profiles

This page reads only the latest assembly calculations. Every curve maps to an explicit PDB entry, official biological assembly and coordinate model.

4q5v__assembly_1__model_1

Assembly 1 · Model 1 · CRYSOL 4.1.3-1-20251215 (887e7ef)

Download this curve (.dat)

4q5v__assembly_1__model_1 | I(q)

100 plotted points; both axes use logarithmic scales.

4q5v__assembly_1__model_1 | P(r) · Pending

P(r) will be calculated and displayed separately for the same assembly/model.

Rg（Guinier）	31.99 Å
Rg (electron density)	31.38 Å
Total Rg	31.99 Å
Atom count	7467
Residues	889
Excluded volume	133080 Å³
Maximum q	0.500 Å⁻¹

Assembly	Model	Structure unit	Oligomeric description	Status	CRYSOL	Actions
1	1	`4q5v__assembly_1__model_1`	trimeric （3）	Success	4.1.3-1-20251215 (887e7ef)	View Download
2	1	`4q5v__assembly_2__model_1`	trimeric （3）	Success	4.1.3-1-20251215 (887e7ef)	View Download

▶

4. Crystallography and Experiment 4. Crystallography & Experiment

▶

5. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Description description	DNA polymerase alpha catalytic subunit
Molecular weight formula_weight	105583.8 kDa
EC 编号 ec_number	2.7.7.7
Mutation mutation	V516A
Source method src_method	man
Copy count entity_count	2

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A,E
Atom count atom_count	15085

DEEQVFHFYWLDAYEDQYNQPGVVFLFGKVWIESAETHVSCCVMVKNIERTLYFLPREMKIDLNTGKETGTPISMKDVYEEFDEKIATKYKIMKFKSKPVEKNYAFEIPDVPEKSEYLEVKYSAEMPQLPQDLKGETFSHVFGTNTSSLELFLMNRKIKGPCWLEVKSPQLLNQPVSWCKAEAMALKPDLVNVIKDVSPPPLVVMAFSMKTMQNAKNHQNEIIAMAALVHHSFALDKAAPKPPFQSHFCVVSKPKDCIFPYAFKEVIEKKNVKVEVAATERTLLGFFLAKVHKIDPDIIVGHNIYGFELEVLLQRINVCKAPHWSKIGRLKRSNMPKLGGRSGFGERNATCGRMICDVEISAKELIRCKSYHLSELVQQILKTERVVIPMENIQNMYSESSQLLYLLEHTWKDAKFILQIMCELNVLPLALQITNIAGNIMSRTLMGGRSERNEFLLLHAFYENNYIVPDKQIFRKPQQKLGDEDEEIDGDTNKYKKGRKKAAYAGGLVLDPKVGFYDKFILLLDFNSLYPSIIQEFNICFTTVQRVASEAQKVTEDGEQEQIPELPDPSLEMGILPREIRKLVERRKQVKQLMKQQDLNPDLILQYDIRQKALKLTANSMYGCLGFSYSRFYAKPLAALVTYKGREILMHTKEMVQKMNLEVIYGDTDSIMINTNSTNLEEVFKLGNKVKSEVNKLYKLLEIDIDGVFKSLLLLKKKKYAALVVEPTSDGNYVTKQELKGLDIVRRDWCDLAKDTGNFVIGQILSDQSRDTIVENIQKRLIEIGENVLNGSVPVSQFEINKALTKDPQDYPDKKSLPHVHVALWINSQGGRKVKAGDTVSYVICQDGSNLTASQRAYAPEQLQKQDNLTIDTQYYLAQQIHPVVARICEPIDGIDAVLIATWLGLDPTQFRVHHYHKDEEN

Source Source

Source organism organism	Homo sapiens
Common name common_name	human
NCBI taxonomy ID ncbi_taxonomy_id	9606
Host organism host_organism	Spodoptera frugiperda

Entity 2 Entity 2 polymer

Description description	RNA primer
Molecular weight formula_weight	3521.2 kDa
Source method src_method	syn
Copy count entity_count	2

Polymer Polymer

Polymer type type	polyribonucleotide
Chain IDs strand_id	B,F

GCCUGGAGCGC

Entity 3 Entity 3 polymer

Description description	DNA template
Molecular weight formula_weight	6423.2 kDa
Source method src_method	syn
Copy count entity_count	2

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	C,G

ATTACTATAGGCGCTCCAGGC

Entity 4 Entity 4 non-polymer

Description description	(3R,4R,4aR,6aS,8R,9R,11aS,11bS)-4,9-bis(hydroxymethyl)-4,11b-dimethyltetradecahydro-8,11a-methanocyclohepta[a]naphthale ne-3,9-diol
Molecular weight formula_weight	338.5 kDa
Source method src_method	syn
Copy count entity_count	2

Entity 5 Entity 5 water

Description description	water
Molecular weight formula_weight	18.0 kDa
Source method src_method	nat
Copy count entity_count	151

▼

6. Fold Classification (SCOP + CATH) 8 domains

CATH v4.4 (8 domains)

Domain ID domain_id	4q5vA01
Class class	2 — Mainly Beta
Architecture architecture	40 — Beta Barrel
Topology topology	50 — OB fold (Dihydrolipoamide Acetyltransferase, E2P)
Homologous superfamily homologous superfamily	730 —

Domain ID domain_id	4q5vA02
Class class	3 — Alpha Beta
Architecture architecture	30 — 2-Layer Sandwich
Topology topology	70 — Alpha-Beta Plaits
Homologous superfamily homologous superfamily	2820 —

Domain ID domain_id	4q5vA03
Class class	3 — Alpha Beta
Architecture architecture	30 — 2-Layer Sandwich
Topology topology	420 — Nucleotidyltransferase; domain 5
Homologous superfamily homologous superfamily	10 — Ribonuclease H-like superfamily/Ribonuclease H

Domain ID domain_id	4q5vA05
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	132 — Topoisomerase I; Chain A, domain 4
Homologous superfamily homologous superfamily	60 — B family DNA polymerase, thumb domain

Domain ID domain_id	4q5vE01
Class class	2 — Mainly Beta
Architecture architecture	40 — Beta Barrel
Topology topology	50 — OB fold (Dihydrolipoamide Acetyltransferase, E2P)
Homologous superfamily homologous superfamily	730 —

Domain ID domain_id	4q5vE02
Class class	3 — Alpha Beta
Architecture architecture	30 — 2-Layer Sandwich
Topology topology	70 — Alpha-Beta Plaits
Homologous superfamily homologous superfamily	2820 —

Domain ID domain_id	4q5vE03
Class class	3 — Alpha Beta
Architecture architecture	30 — 2-Layer Sandwich
Topology topology	420 — Nucleotidyltransferase; domain 5
Homologous superfamily homologous superfamily	10 — Ribonuclease H-like superfamily/Ribonuclease H

Domain ID domain_id	4q5vE05
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	132 — Topoisomerase I; Chain A, domain 4
Homologous superfamily homologous superfamily	60 — B family DNA polymerase, thumb domain

▶

Unit-cell length a length_a	105.051 Å
Unit-cell length b length_b	116.432 Å
Unit-cell length c length_c	233.026 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	90.00 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	8

Space group space_group	P 21 21 21
Space-group number int_tables_number	19
Crystal system crystal_system	—

Resolution resolution	2.520 Å
Low-resolution limit resolution_low	78.020 Å
R factor r_factor	0.2330
R_work r_work	0.2330
R_free r_free	0.2680

Crystal structure of the catalytic core of human DNA polymerase alpha in ternary complex with an RNA-primed DNA template and aphidicolin

1. Protein Identity and Related Structures Protein Identity & Related Structures

DNA polymerase alpha catalytic subunit

State in the Current Structure

Other States of the Same Protein in the Database

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

4q5v__assembly_1__model_1

4q5v__assembly_1__model_1 | I(q)

4q5v__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 polymer

Polymer Polymer

Entity 4 Entity 4 non-polymer

Entity 5 Entity 5 water

6. Fold Classification (SCOP + CATH) 8 domains

CATH v4.4 (8 domains)

7. Citations (1)

Crystal structure of the catalytic core of human DNA polymerase alpha in ternary complex with an RNA-primed DNA template and aphidicolin

1. Protein Identity and Related Structures Protein Identity & Related Structures

DNA polymerase alpha catalytic subunit

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

4q5v__assembly_1__model_1

4q5v__assembly_1__model_1 | I(q)

4q5v__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 polymer

Polymer Polymer

Entity 4 Entity 4 non-polymer

Entity 5 Entity 5 water

6. Fold Classification (SCOP + CATH) 8 domains

CATH v4.4 (8 domains)

7. Citations (1)