4qcl

Crystal structure of the catalytic core of human DNA polymerase alpha in ternary complex with an RNA-primed DNA template and dCTP

Method: X-RAY DIFFRACTION D_max: 100.9 Å Quality: GOOD

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

DNA polymerase alpha catalytic subunit

Homo sapiens

State in the Current Structure

Assembly	Oligomeric State	Construct	Mutations and Modifications	Ligands, Ions and Associated Components	Method and Experimental Conditions	Structure Quality
1	Protein–DNA Monomer Protein × 1 DNA 2 PDB declaration: trimeric（3） Consistent with all polymer counts	Chain A； UniProt 336–1257	Fragment：Human dna polymerase apha catalytic core domain residues 336-1257 Mutation：V516A	RNA PRIMER × 1 DNA TEMPLATE × 1 DCP 2'-DEOXYCYTIDINE-5'-TRIPHOSPHATE × 1 MG MAGNESIUM ION × 1 ZN ZINC ION × 3 K POTASSIUM ION × 1 1PE PENTAETHYLENE GLYCOL × 1 EDO 1,2-ETHANEDIOL × 1	X-RAY DIFFRACTION X-ray crystallization conditions：VAPOR DIFFUSION, SITTING DROP；pH 6.5；298 K；reservoir solution: 0.8 mm zinc sulfate, 50 mm MES buffer pH 6.5, 8.8% v/v PEG MME 550; cryo solution: 100 mm potassium chloride, 0.8 mm zinc sulfate, 50 mm MES buffer pH 6.5, 1.1 magnesium chloride, 15% v/v PEG MME 550, 15% v/v ethylene glycol;, VAPOR DIFFUSION, SITTING DROP, temperature 298K	Resolution 2.20 Å R-free 0.239

Other States of the Same Protein in the Database

Each row is a biological assembly of the same UniProt protein in another PDB entry. The “Difference from current entry” column identifies evidence-level differences; no tag means the currently parsed fields agree.

Other PDB	Difference from Current Entry 4QCL	Assembly / Oligomeric State	Construct	Mutations and Modifications	Ligands, Ions and Non-polymers	Method and Experimental Conditions	Structure Quality
1K0P NMR Structures of the Zinc Finger Domain of Human DNA Polymerase-alpha Deposited 2001-09-20	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain A 1347–1377（31 aa） Fragment：zinc finger domain (residues 1347-1377)	Not recorded	No recorded non-water small molecule	SOLUTION NMR NMR measurement conditions pH 6.8；296 K；Pressure ambient NMR sample composition 3mM Zinc Finger Domain; 3.6mM Zn(II)nitrate \| 90% H2O/10% D2O	Resolution not provided
1K18 Minimized Average NMR Structure of the Zinc Finger Domain of Human DNA Polymerase-alpha Deposited 2001-09-24	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain A 1347–1377（31 aa） Fragment：zinc finger domain (residues 1347-1377)	Not recorded	No recorded non-water small molecule	SOLUTION NMR NMR measurement conditions pH 6.8；296 K；Pressure ambient NMR sample composition 3mM Zinc Finger Peptide; 3.6 mM Zn(II)nitrate \| 90% H2O/10% D2O	Resolution not provided
1N5G NMR Structures of the Zinc Finger Domain of Human DNA Polymerase-alpha Deposited 2002-11-05	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain A 1345–1382（38 aa） Fragment：zinc finger domain (residues 1345-1382)	Not recorded	No recorded non-water small molecule	SOLUTION NMR NMR measurement conditions pH 6.2；296 K；Pressure ambient NMR sample composition 3mM peptide, 3.6mM Zn(II)nitrate \| 90% H2O/10% D2O	Resolution not provided
4BPX Crystal structure of human primase in complex with the primase- binding motif of DNA polymerase alpha Deposited 2013-05-28	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Insufficient information Heteromer；Protein × 2 PDB declaration: dimeric	Chain D 1445–1462（18 aa） Fragment：PRIMASE-BINDING MOTIF RESIDUES 1445-1462, PRIL RESIDUES 19-253	Not recorded	ZN ZINC ION × 1	X-RAY DIFFRACTION X-ray crystallization conditions 100MM TRIS-HCL/BICINE PH 8.5, 20% GLYCEROL, 10% PEG4000 AND 20MM EACH OF AN ALCOHOL MIX COMPRISING 1,6-HEXANEDIOL, 1-BUTANOL, 1,2-PROPANEDIOL, 2-PROPANOL, 1,4- BUTANEDIOL AND 1,3-PROPANEDIOL.	Resolution 3.40 Å R-free 0.267
4BPX Crystal structure of human primase in complex with the primase- binding motif of DNA polymerase alpha Deposited 2013-05-28	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 3 Insufficient information Monomer；Protein × 1 PDB declaration: monomeric	Chain B 1445–1462（18 aa） Fragment：PRIMASE-BINDING MOTIF RESIDUES 1445-1462, PRIL RESIDUES 19-253	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions 100MM TRIS-HCL/BICINE PH 8.5, 20% GLYCEROL, 10% PEG4000 AND 20MM EACH OF AN ALCOHOL MIX COMPRISING 1,6-HEXANEDIOL, 1-BUTANOL, 1,2-PROPANEDIOL, 2-PROPANOL, 1,4- BUTANEDIOL AND 1,3-PROPANEDIOL.	Resolution 3.40 Å R-free 0.267
4Q5V Crystal structure of the catalytic core of human DNA polymerase alpha in ternary complex with an RNA-primed DNA template and aphidicolin Deposited 2014-04-17	Different construct Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Other combination Monomer；Protein × 1 PDB declaration: trimeric	Chain A 336–1257（922 aa） Fragment：Human DNA polymerase apha catalytic core domain residues 336-1257	Mutation：V516A	2ZE (3R,4R,4aR,6aS,8R,9R,11aS,11bS)-4,9-bis(hydroxymethyl)-4,11b-dimethyltetradecahydro-8,11a-methanocyclohepta[a]naphthale ne-3,9-diol × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 6.5；295 K；100 mM KCl, 12.5 mM MgCl2, 25 mM Na-Cacodylate, pH 6.5, 6 % 2-propanol, 2 mM TCEP, VAPOR DIFFUSION, SITTING DROP, temperature 295 K	Resolution 2.52 Å R-free 0.268
4Q5V Crystal structure of the catalytic core of human DNA polymerase alpha in ternary complex with an RNA-primed DNA template and aphidicolin Deposited 2014-04-17	Different construct Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 2 Other combination Monomer；Protein × 1 PDB declaration: trimeric	Chain E 336–1257（922 aa） Fragment：Human DNA polymerase apha catalytic core domain residues 336-1257	Mutation：V516A	2ZE (3R,4R,4aR,6aS,8R,9R,11aS,11bS)-4,9-bis(hydroxymethyl)-4,11b-dimethyltetradecahydro-8,11a-methanocyclohepta[a]naphthale ne-3,9-diol × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 6.5；295 K；100 mM KCl, 12.5 mM MgCl2, 25 mM Na-Cacodylate, pH 6.5, 6 % 2-propanol, 2 mM TCEP, VAPOR DIFFUSION, SITTING DROP, temperature 295 K	Resolution 2.52 Å R-free 0.268
4Y97 Crystal Structure of human Pol alpha B-subunit in complex with C-terminal domain of catalytic subunit Deposited 2015-02-17	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein heterocomplex Heteromer；Protein × 2 PDB declaration: dimeric	Chain B 1265–1444（180 aa） Fragment：UNP residues 1265-1444	Not recorded	ZN ZINC ION × 2	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 5.6；295 K；The diffraction quality crystals are growing in 2-3 weeks in 100 mM ammonium acetate, 50 mM Na citrate pH 5.6, 10 - 10.4% w/v PEG 4000, 2 mM TCEP and 50 mM guanidine HCl.	Resolution 2.51 Å R-free 0.257
4Y97 Crystal Structure of human Pol alpha B-subunit in complex with C-terminal domain of catalytic subunit Deposited 2015-02-17	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 2 Protein heterocomplex Heteromer；Protein × 2 PDB declaration: dimeric	Chain D 1265–1444（180 aa） Fragment：UNP residues 1265-1444	Not recorded	ZN ZINC ION × 2	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 5.6；295 K；The diffraction quality crystals are growing in 2-3 weeks in 100 mM ammonium acetate, 50 mM Na citrate pH 5.6, 10 - 10.4% w/v PEG 4000, 2 mM TCEP and 50 mM guanidine HCl.	Resolution 2.51 Å R-free 0.257
4Y97 Crystal Structure of human Pol alpha B-subunit in complex with C-terminal domain of catalytic subunit Deposited 2015-02-17	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 3 Protein heterocomplex Heteromer；Protein × 2 PDB declaration: dimeric	Chain F 1265–1444（180 aa） Fragment：UNP residues 1265-1444	Not recorded	ZN ZINC ION × 2	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 5.6；295 K；The diffraction quality crystals are growing in 2-3 weeks in 100 mM ammonium acetate, 50 mM Na citrate pH 5.6, 10 - 10.4% w/v PEG 4000, 2 mM TCEP and 50 mM guanidine HCl.	Resolution 2.51 Å R-free 0.257
4Y97 Crystal Structure of human Pol alpha B-subunit in complex with C-terminal domain of catalytic subunit Deposited 2015-02-17	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 4 Protein heterocomplex Heteromer；Protein × 2 PDB declaration: dimeric	Chain H 1265–1444（180 aa） Fragment：UNP residues 1265-1444	Not recorded	ZN ZINC ION × 2	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 5.6；295 K；The diffraction quality crystals are growing in 2-3 weeks in 100 mM ammonium acetate, 50 mM Na citrate pH 5.6, 10 - 10.4% w/v PEG 4000, 2 mM TCEP and 50 mM guanidine HCl.	Resolution 2.51 Å R-free 0.257
5EXR Crystal structure of human primosome Deposited 2015-11-24	Different construct Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein heterocomplex Heteromer；Protein × 4 PDB declaration: tetrameric	Chain C 335–1462（1128 aa）	Mutation：V516A	ZN ZINC ION × 3 SF4 IRON/SULFUR CLUSTER × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 8.5；295 K；0.2 M lithium sulphate, 50 mM TRIS HCl pH 8.5, 2 mM TCEP pH 7.5, 11.2% w/v PEG 4,000, 3% v/v ethanol, 0.5% v/v polypropylene glycol P400 and 0.2 mM EDTA	Resolution 3.60 Å R-free 0.326
5EXR Crystal structure of human primosome Deposited 2015-11-24	Different construct Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 2 Protein heterocomplex Heteromer；Protein × 4 PDB declaration: tetrameric	Chain G 335–1462（1128 aa）	Mutation：V516A	ZN ZINC ION × 3 SF4 IRON/SULFUR CLUSTER × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 8.5；295 K；0.2 M lithium sulphate, 50 mM TRIS HCl pH 8.5, 2 mM TCEP pH 7.5, 11.2% w/v PEG 4,000, 3% v/v ethanol, 0.5% v/v polypropylene glycol P400 and 0.2 mM EDTA	Resolution 3.60 Å R-free 0.326
5IUD Human DNA polymerase alpha in binary complex with a DNA:DNA template-primer Deposited 2016-03-17	Different construct Different mutation/modification Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: trimeric	Chain A 338–1255（918 aa） Fragment：UNP Residues 338-1255	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 5.5；293 K；10% polyethylene glycol 4000, 0.2M sodium citrate, 10% isopropanol, 0.1M sodium citrate buffer (pH = 5.5)	Resolution 3.30 Å R-free 0.228
5IUD Human DNA polymerase alpha in binary complex with a DNA:DNA template-primer Deposited 2016-03-17	Different construct Different mutation/modification Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 2 Protein–DNA Monomer；Protein × 1 PDB declaration: trimeric	Chain D 338–1255（918 aa） Fragment：UNP Residues 338-1255	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 5.5；293 K；10% polyethylene glycol 4000, 0.2M sodium citrate, 10% isopropanol, 0.1M sodium citrate buffer (pH = 5.5)	Resolution 3.30 Å R-free 0.228
5IUD Human DNA polymerase alpha in binary complex with a DNA:DNA template-primer Deposited 2016-03-17	Different construct Different mutation/modification Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 3 Protein–DNA Monomer；Protein × 1 PDB declaration: trimeric	Chain G 338–1255（918 aa） Fragment：UNP Residues 338-1255	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 5.5；293 K；10% polyethylene glycol 4000, 0.2M sodium citrate, 10% isopropanol, 0.1M sodium citrate buffer (pH = 5.5)	Resolution 3.30 Å R-free 0.228
5IUD Human DNA polymerase alpha in binary complex with a DNA:DNA template-primer Deposited 2016-03-17	Different construct Different mutation/modification Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 4 Protein–DNA Monomer；Protein × 1 PDB declaration: trimeric	Chain J 338–1255（918 aa） Fragment：UNP Residues 338-1255	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 5.5；293 K；10% polyethylene glycol 4000, 0.2M sodium citrate, 10% isopropanol, 0.1M sodium citrate buffer (pH = 5.5)	Resolution 3.30 Å R-free 0.228
6AS7 CRYSTAL STRUCTURE OF THE CATALYTIC CORE OF HUMAN DNA POLYMERASE ALPHA IN TERNARY COMPLEX WITH AN DNA-PRIMED DNA TEMPLATE AND DCTP Deposited 2017-08-23	Different construct Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: trimeric	Chain A 336–1257（922 aa）	Mutation：V516A	DCP 2'-DEOXYCYTIDINE-5'-TRIPHOSPHATE × 1 MG MAGNESIUM ION × 2 CO COBALT (II) ION × 2	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 4.6；298 K；6MM COCL2, 2 MM TCEP, 50 MM NA ACETATE PH 4.6, 225 MM 1,6HEXADEDIOL	Resolution 2.95 Å R-free 0.301
7N2M Crystal structure of DNA polymerase alpha catalytic core in complex with dCTP and template/primer having T-C mismatch at the post-insertion site Deposited 2021-05-29	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Other combination Monomer；Protein × 1 PDB declaration: trimeric	Chain A 336–1257（922 aa）	Not recorded	DCP 2'-DEOXYCYTIDINE-5'-TRIPHOSPHATE × 1 MG MAGNESIUM ION × 1 ZN ZINC ION × 4 K POTASSIUM ION × 1 1PE PENTAETHYLENE GLYCOL × 1 SO4 SULFATE ION × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 6.5；295 K；0.8 mM zinc sulfate, 8.8% v/v PEG MME 550, and 50 mM MES pH 6.5	Resolution 2.90 Å R-free 0.228
7OPL CryoEM structure of DNA Polymerase alpha - primase bound to SARS CoV nsp1 Deposited 2021-06-01	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein heterocomplex Heteromer；Protein × 5 PDB declaration: pentameric	Chain A 334–1462（1129 aa）	Not recorded	ZN ZINC ION × 3 SF4 IRON/SULFUR CLUSTER × 1	ELECTRON MICROSCOPY cryo-EM buffer pH 7.2 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 4.12 Å
7U5C Cryo-EM structure of human CST bound to DNA polymerase alpha-primase in a recruitment state Deposited 2022-03-02	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Heteromer；Protein × 7 PDB declaration: octameric	Chain C 335–1462（1128 aa）	Not recorded	ZN ZINC ION × 4 SF4 IRON/SULFUR CLUSTER × 1	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 4.60 Å
8B9D Human replisome bound by Pol Alpha Deposited 2022-10-05	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Heteromer；Protein × 21 PDB declaration: 23-meric	Chain B 1–1462（1462 aa）	Not recorded	ANP PHOSPHOAMINOPHOSPHONIC ACID-ADENYLATE ESTER × 3 MG MAGNESIUM ION × 3 ZN ZINC ION × 4	ELECTRON MICROSCOPY cryo-EM buffer pH 7.6 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.40 Å
8D0B Human CST-DNA polymerase alpha/primase preinitiation complex bound to 4xTEL-foldback template Deposited 2022-05-26	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Heteromer；Protein × 7 PDB declaration: octameric	Chain F 324–1462（1139 aa）	Not recorded	No recorded non-water small molecule	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5；CHAPSO is only added just before sample vitrification. cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.43 Å
8D0K Human CST-DNA polymerase alpha/primase preinitiation complex bound to 4xTEL-foldback template - PRIM2C advanced PIC Deposited 2022-05-26	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Heteromer；Protein × 7 PDB declaration: octameric	Chain F 2–1462（1461 aa）	Not recorded	No recorded non-water small molecule	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5；CHAPSO is only added just before sample vitrification. cryo-EM vitrification conditions Cryogen ETHANE	Resolution 4.27 Å
8D96 Human DNA polymerase alpha/primase elongation complex I bound to primer/template Deposited 2022-06-09	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Heteromer；Protein × 2 PDB declaration: tetrameric	Chain C 1–1462（1462 aa）	Not recorded	SF4 IRON/SULFUR CLUSTER × 1 MG MAGNESIUM ION × 1 DTP 2'-DEOXYADENOSINE 5'-TRIPHOSPHATE × 1	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5；CHAPSO is made fresh at 80 mM before added to the sample at a final concentration of 4-8 mM immediately before vitrification. cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.35 Å
8D9D Human DNA polymerase-alpha/primase elongation complex II bound to primer/template Deposited 2022-06-09	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Heteromer；Protein × 4 PDB declaration: hexameric	Chain C 1–1462（1462 aa）	Not recorded	ZN ZINC ION × 3 SF4 IRON/SULFUR CLUSTER × 1 MG MAGNESIUM ION × 2 DTP 2'-DEOXYADENOSINE 5'-TRIPHOSPHATE × 1	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5；CHAPSO is made fresh at 80 mM before added to the sample at a final concentration of 4-8 mM immediately before vitrification. cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.59 Å
8QJ7 Cryo-EM structure of human DNA polymerase alpha-primase in pre-initiation stage 1 Deposited 2023-09-12	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein heterocomplex Heteromer；Protein × 4 PDB declaration: tetrameric	Chain A 1–1462（1462 aa）	Not recorded	ZN ZINC ION × 3 MN MANGANESE (II) ION × 2 ATP ADENOSINE-5'-TRIPHOSPHATE × 1 SF4 IRON/SULFUR CLUSTER × 1	ELECTRON MICROSCOPY cryo-EM buffer pH 7.4 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.07 Å
8VY3 Human DNA polymerase alpha/primase - AavLEA1 (1:40 molar ratio) Deposited 2024-02-06	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein heterocomplex Heteromer；Protein × 4 PDB declaration: tetrameric	Chain C 338–1456（1119 aa）	Not recorded	ZN ZINC ION × 3 SF4 IRON/SULFUR CLUSTER × 1	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 2.98 Å
9C8V Human DNA polymerase alpha/primase - CHAPSO (4 mM) Deposited 2024-06-13	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein heterocomplex Heteromer；Protein × 4 PDB declaration: tetrameric	Chain C 338–1456（1119 aa）	Not recorded	ZN ZINC ION × 3 SF4 IRON/SULFUR CLUSTER × 1	ELECTRON MICROSCOPY cryo-EM buffer pH 7 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.39 Å
9MJ5 Catalytic domain of human DNA polymerase alpha in complex with DNA and RPA Deposited 2024-12-13	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Heteromer；Protein × 4 PDB declaration: hexameric	Chain S 335–1244（910 aa）	Not recorded	ZN ZINC ION × 1 MG MAGNESIUM ION × 1 DCP 2'-DEOXYCYTIDINE-5'-TRIPHOSPHATE × 1	ELECTRON MICROSCOPY cryo-EM buffer pH 7.7 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.50 Å

21 other PDB entries and 30 assemblies. Open the comparison page and filter oligomeric states

View Construct and Data Evidence

UniProt name	DPOLA_HUMAN
Isoform	—
PDB entities	1
Chains and sequence ranges	Author chain A； PDBConstruct 1–922； UniProt 336–1257

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

SAXS scattering curve SAXS Profile

P(r) Distance Distribution P(r) Distribution

Download Download SAXS (.dat) P(r) (.pr.out) CIF

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	4qcl
Deposition date deposition_date	2014-05-12
Structure title title	Crystal structure of the catalytic core of human DNA polymerase alpha in ternary complex with an RNA-primed DNA template and dCTP
Keywords keywords	B-FAMILY DNA POLYMERASE, DNA REPLICATION, TRANSFERASE-DNA-RNA COMPLEX; TRANSFERASE/DNA/RNA
Experimental Method method	X-RAY DIFFRACTION

▼

3. SAXS Parameters (CRYSOL theoretical calculation) 3. SAXS Parameters (CRYSOL)

Radius of gyration Rg (Guinier) rg_guinier	31.75 Å
Radius of gyration Rg (electron density) rg_electron	31.27 Å
Forward intensity I(0) i0	187397000.00
Molecular weight molecular_weight	107310.0 kDa
Excluded volume excluded_volume	133540 Å³
Envelope volume envelope_volume	171280 Å³
Hydration-shell volume shell_volume	44892 Å³
Envelope diameter envelope_diameter	103.7 Å
Shell Rg shell_rg	39.01 Å
Envelope Rg envelope_rg	31.10 Å
Shape Rg shape_rg	31.28 Å
Total Rg total_rg	31.86 Å
Total atoms total_atoms	7496
Residues n_residues	889
Spherical-harmonic order n_harmonics	20
q range q_range	— – 0.5000 Å⁻¹
Data points n_points	101
Shell type shell_type	directional
Solvent electron density solvent_density	0.3340 e/Å³
Shell contrast contrast_shell	0.0300 e/Å³
CRYSOL version crysol_version	4.1.3

▼

4. P(r) Distance Distribution (GNOM inversion) 4. P(r) Analysis (GNOM)

Maximum dimension Dmax dmax	100.9 Å
Rg (real space) rg_real	31.61 Å
Rg uncertainty (real space) rg_real_error	0.57 Å
I(0) (real space) i0_real	1.8740e+08
I(0) uncertainty (real space) i0_real_error	2.6420e+06
Rg (reciprocal space) rg_reciprocal	31.67 Å
I(0) (reciprocal space) i0_reciprocal	187400000.0000
Solution quality estimate total_estimate	0.8985
Solution quality rating solution_quality	GOOD a GOOD solution
P(r) peaks n_peaks	1
Primary peak position r_peak_primary	40.4 Å
Skewness Skewness skewness	0.201
Kurtosis Kurtosis kurtosis	-0.473
Angular range angular_range	— – 0.2500 Å⁻¹
Current regularization parameter α current_alpha	0.0000
Highest regularization parameter α highest_alpha	51050000.0000
Real-space data points n_real_points	51
GNOM version gnom_version	4.1.3
Quality Criteria quality_criteria	AN1: 0.000; Oscil: 0.921; Stabil: 1.000; Sysdev: 1.000; Positv: 1.000; Valcen: 0.995; Smooth: 0.918

▶

5. Crystallography and Experiment 5. Crystallography & Experiment

▶

6. Entities and Polymers Entities & Polymers (10)

Entity 1 Entity 1 polymer

Description description	DNA polymerase alpha catalytic subunit
Molecular weight formula_weight	105583.8 kDa
EC 编号 ec_number	2.7.7.7
Mutation mutation	V516A
Source method src_method	man
Copy count entity_count	1

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A
Atom count atom_count	7910

DEEQVFHFYWLDAYEDQYNQPGVVFLFGKVWIESAETHVSCCVMVKNIERTLYFLPREMKIDLNTGKETGTPISMKDVYEEFDEKIATKYKIMKFKSKPVEKNYAFEIPDVPEKSEYLEVKYSAEMPQLPQDLKGETFSHVFGTNTSSLELFLMNRKIKGPCWLEVKSPQLLNQPVSWCKAEAMALKPDLVNVIKDVSPPPLVVMAFSMKTMQNAKNHQNEIIAMAALVHHSFALDKAAPKPPFQSHFCVVSKPKDCIFPYAFKEVIEKKNVKVEVAATERTLLGFFLAKVHKIDPDIIVGHNIYGFELEVLLQRINVCKAPHWSKIGRLKRSNMPKLGGRSGFGERNATCGRMICDVEISAKELIRCKSYHLSELVQQILKTERVVIPMENIQNMYSESSQLLYLLEHTWKDAKFILQIMCELNVLPLALQITNIAGNIMSRTLMGGRSERNEFLLLHAFYENNYIVPDKQIFRKPQQKLGDEDEEIDGDTNKYKKGRKKAAYAGGLVLDPKVGFYDKFILLLDFNSLYPSIIQEFNICFTTVQRVASEAQKVTEDGEQEQIPELPDPSLEMGILPREIRKLVERRKQVKQLMKQQDLNPDLILQYDIRQKALKLTANSMYGCLGFSYSRFYAKPLAALVTYKGREILMHTKEMVQKMNLEVIYGDTDSIMINTNSTNLEEVFKLGNKVKSEVNKLYKLLEIDIDGVFKSLLLLKKKKYAALVVEPTSDGNYVTKQELKGLDIVRRDWCDLAKDTGNFVIGQILSDQSRDTIVENIQKRLIEIGENVLNGSVPVSQFEINKALTKDPQDYPDKKSLPHVHVALWINSQGGRKVKAGDTVSYVICQDGSNLTASQRAYAPEQLQKQDNLTIDTQYYLAQQIHPVVARICEPIDGIDAVLIATWLGLDPTQFRVHHYHKDEEN

来源 Source

来源生物 organism	Homo sapiens
通用名 common_name	human
NCBI Class编号 ncbi_taxonomy_id	9606
宿主生物 host_organism	SPODOPTERA FRUGIPERDA

Entity 2 Entity 2 polymer

Description description	RNA PRIMER
Molecular weight formula_weight	3521.2 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide/polyribonucleotide hybrid
Chain IDs strand_id	B

GCCUGGAGCGC

Entity 3 Entity 3 polymer

Description description	DNA TEMPLATE
Molecular weight formula_weight	6423.2 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	C

ATTACTATAGGCGCTCCAGGC

Entity 4 Entity 4 non-polymer

Description description	2'-DEOXYCYTIDINE-5'-TRIPHOSPHATE
Molecular weight formula_weight	467.2 kDa
Source method src_method	syn
Copy count entity_count	1

Entity 5 Entity 5 non-polymer

Description description	MAGNESIUM ION
Molecular weight formula_weight	24.3 kDa
Source method src_method	syn
Copy count entity_count	1

Entity 6 Entity 6 non-polymer

Description description	ZINC ION
Molecular weight formula_weight	65.4 kDa
Source method src_method	syn
Copy count entity_count	3

Entity 7 Entity 7 non-polymer

Description description	POTASSIUM ION
Molecular weight formula_weight	39.1 kDa
Source method src_method	syn
Copy count entity_count	1

Entity 8 Entity 8 non-polymer

Description description	PENTAETHYLENE GLYCOL
Molecular weight formula_weight	238.3 kDa
Source method src_method	syn
Copy count entity_count	1

Entity 9 Entity 9 non-polymer

Description description	1,2-ETHANEDIOL
Molecular weight formula_weight	62.1 kDa
Source method src_method	syn
Copy count entity_count	1

Entity 10 Entity 10 water

Description description	water
Molecular weight formula_weight	18.0 kDa
Source method src_method	nat
Copy count entity_count	414

▼

7. Fold Classification (SCOP + CATH) 4 domains

CATH v4.4 (4 domains)

Domain ID domain_id	4qclA01
Class class	2 — Mainly Beta
Architecture architecture	40 — Beta Barrel
Topology topology	50 — OB fold (Dihydrolipoamide Acetyltransferase, E2P)
Homologous superfamily homologous superfamily	730 —

Domain ID domain_id	4qclA02
Class class	3 — Alpha Beta
Architecture architecture	30 — 2-Layer Sandwich
Topology topology	70 — Alpha-Beta Plaits
Homologous superfamily homologous superfamily	2820 —

Domain ID domain_id	4qclA03
Class class	3 — Alpha Beta
Architecture architecture	30 — 2-Layer Sandwich
Topology topology	420 — Nucleotidyltransferase; domain 5
Homologous superfamily homologous superfamily	10 — Ribonuclease H-like superfamily/Ribonuclease H

Domain ID domain_id	4qclA05
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	132 — Topoisomerase I; Chain A, domain 4
Homologous superfamily homologous superfamily	60 — B family DNA polymerase, thumb domain

▶

8. Citations (1)

▶

Unit-cell length a length_a	140.763 Å
Unit-cell length b length_b	140.763 Å
Unit-cell length c length_c	181.315 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	90.00 °
Unit-cell angle γ angle_gamma	120.00 °
Molecules per unit cell Z z_pdb	6

Space group space_group	P 32 2 1
Space-group number int_tables_number	154
Crystal system crystal_system	—

Resolution resolution	2.200 Å
Low-resolution limit resolution_low	29.510 Å
R factor r_factor	0.2100
R_work r_work	0.2100
R_free r_free	0.2390

fit	/app/data/saxs_computation/qc/4qcl/4qcl.fit
pddf	/app/data/pr_computation/qc/4qcl/4qcl.pr.out
profile	/app/data/saxs_computation/qc/4qcl/4qcl.dat

Crystal structure of the catalytic core of human DNA polymerase alpha in ternary complex with an RNA-primed DNA template and dCTP

1. Protein Identity and Related Structures Protein Identity & Related Structures

DNA polymerase alpha catalytic subunit

State in the Current Structure

Other States of the Same Protein in the Database

SAXS scattering curve SAXS Profile

P(r) Distance Distribution P(r) Distribution

2. Structure Basics 2. Structure Basics

3. SAXS Parameters (CRYSOL theoretical calculation) 3. SAXS Parameters (CRYSOL)

4. P(r) Distance Distribution (GNOM inversion) 4. P(r) Analysis (GNOM)

5. Crystallography and Experiment 5. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

6. Entities and Polymers Entities & Polymers (10)

Entity 1 Entity 1 polymer

Polymer Polymer

来源 Source

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 polymer

Polymer Polymer

Entity 4 Entity 4 non-polymer

Entity 5 Entity 5 non-polymer

Entity 6 Entity 6 non-polymer

Entity 7 Entity 7 non-polymer

Entity 8 Entity 8 non-polymer

Entity 9 Entity 9 non-polymer

Entity 10 Entity 10 water

7. Fold Classification (SCOP + CATH) 4 domains

CATH v4.4 (4 domains)

8. Citations (1)

9. Files and Curves (10)

Files (7)

Curves (3)