4u7d

Structure of human RECQ-like helicase in complex with an oligonucleotide

Method: X-RAY DIFFRACTION

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

ATP-dependent DNA helicase Q1

Homo sapiens

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–DNA	Homooligomer	Protein 2 DNA 2	DNA oligonucleotide × 2 ZINC ION × 2	Consistent with all polymers
2	Protein–DNA	Homooligomer	Protein 2 DNA 2	DNA oligonucleotide × 2 ZINC ION × 2	Consistent with all polymers
3	Protein–DNA	Homooligomer	Protein 2 DNA 2	DNA oligonucleotide × 2 ZINC ION × 2	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	RECQ1_HUMAN
Isoform	—
PDB entities	1
Chains and sequence ranges	Author chain A； PDBConstruct 2–569； UniProt 49–616 Author chain B； PDBConstruct 2–569； UniProt 49–616 Author chain C； PDBConstruct 2–569； UniProt 49–616 Author chain D； PDBConstruct 2–569； UniProt 49–616

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	4u7d
Deposition date deposition_date	2014-07-30
Structure title title	Structure of human RECQ-like helicase in complex with an oligonucleotide
Keywords keywords	;HYDROLASE-DNA COMPLEX, NUCLEAR PROTEIN, HYDROLASE, DNA STRAND ANNEALING, DNA BINDING PROTEIN, Structural Genomics, Structural Genomics Consortium, SGC ;; HYDROLASE/DNA
Experimental Method method	X-RAY DIFFRACTION

▼

3. Official assembly/model SAXS Official SAXS Profiles

This page reads only the latest assembly calculations. Every curve maps to an explicit PDB entry, official biological assembly and coordinate model.

4u7d__assembly_1__model_1

Assembly 1 · Model 1 · CRYSOL 4.1.3-1-20251215 (887e7ef)

Download this curve (.dat)

4u7d__assembly_1__model_1 | I(q)

100 plotted points; both axes use logarithmic scales.

4u7d__assembly_1__model_1 | P(r) · Pending

P(r) will be calculated and displayed separately for the same assembly/model.

Rg（Guinier）	41.96 Å
Rg (electron density)	42.84 Å
Total Rg	42.78 Å
Atom count	8744
Residues	1087
Excluded volume	154520 Å³
Maximum q	0.500 Å⁻¹

Assembly	Model	Structure unit	Oligomeric description	Status	CRYSOL	Actions
1	1	`4u7d__assembly_1__model_1`	tetrameric （4）	Success	4.1.3-1-20251215 (887e7ef)	View Download
2	1	`4u7d__assembly_2__model_1`	tetrameric （4）	Success	4.1.3-1-20251215 (887e7ef)	View Download
3	1	`4u7d__assembly_3__model_1`	tetrameric （4）	Success	4.1.3-1-20251215 (887e7ef)	View Download

▶

4. Crystallography and Experiment 4. Crystallography & Experiment

▶

5. Entities and Polymers Entities & Polymers (3)

Entity 1 Entity 1 polymer

Description description	ATP-dependent DNA helicase Q1
Molecular weight formula_weight	67415.0 kDa
EC 编号 ec_number	3.6.4.12
Source method src_method	man
Copy count entity_count	4

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A,B,C,D
Atom count atom_count	17224

MCLEDSDAGASNEYDSSPAAWNKEDFPWSGKVKDILQNVFKLEKFRPLQLETINVTMAGKEVFLVMPTGGGKSLCYQLPALCSDGFTLVICPLISLMEDQLMVLKQLGISATMLNASSSKEHVKWVHAEMVNKNSELKLIYVTPEKIAKSKMFMSRLEKAYEARRFTRIAVDEVHCCSQWGHDFRPDYKALGILKRQFPNASLIGLTATATNHVLTDAQKILCIEKCFTFTASFNRPNLYYEVRQKPSNTEDFIEDIVKLINGRYKGQSGIIYCFSQKDSEQVTVSLQNLGIHAGAYHANLEPEDKTTVHRKWSANEIQVVVATVAFGMGIDKPDVRFVIHHSMSKSMENYYQESGRAGRDDMKADCILYYGFGDIFRISSMVVMENVGQQKLYEMVSYCQNISKCRRVLMAQHFDEVWNSEACNKMCDNCCKDSAFERKNITEYCRDLIKILKQAEELNEKLTPLKLIDSWMGKGAAKLRVAGVVAPTLPREDLEKIIAHFLIQQYLKEDYSFTAYATISYLKIGPKANLLNNEAHAITMQVTKSTQNSFRAESSQTCHSEQSDKKMEAENLYFQSHHHHHHDYKDDDDK

Source Source

Source organism organism	Homo sapiens
Common name common_name	Human
NCBI taxonomy ID ncbi_taxonomy_id	9606
Host organism host_organism	Escherichia coli BL21(DE3)

Entity 2 Entity 2 polymer

Description description	DNA oligonucleotide
Molecular weight formula_weight	6036.9 kDa
Source method src_method	syn
Copy count entity_count	4

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	P,Q,R,S

GGATCTCGACGCTCTCCCTT

Entity 3 Entity 3 non-polymer

Description description	ZINC ION
Molecular weight formula_weight	65.4 kDa
Source method src_method	syn
Copy count entity_count	4

▼

6. Fold Classification (SCOP + CATH) 12 domains

CATH v4.4 (12 domains)

Domain ID domain_id	4u7dA01
Class class	3 — Alpha Beta
Architecture architecture	40 — 3-Layer(aba) Sandwich
Topology topology	50 — Rossmann fold
Homologous superfamily homologous superfamily	300 — P-loop containing nucleotide triphosphate hydrolases

Domain ID domain_id	4u7dA02
Class class	3 — Alpha Beta
Architecture architecture	40 — 3-Layer(aba) Sandwich
Topology topology	50 — Rossmann fold
Homologous superfamily homologous superfamily	300 — P-loop containing nucleotide triphosphate hydrolases

Domain ID domain_id	4u7dA03
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	10 — Arc Repressor Mutant, subunit A
Homologous superfamily homologous superfamily	10 — Winged helix-like DNA-binding domain superfamily/Winged helix DNA-binding domain

Domain ID domain_id	4u7dB01
Class class	3 — Alpha Beta
Architecture architecture	40 — 3-Layer(aba) Sandwich
Topology topology	50 — Rossmann fold
Homologous superfamily homologous superfamily	300 — P-loop containing nucleotide triphosphate hydrolases

Domain ID domain_id	4u7dB02
Class class	3 — Alpha Beta
Architecture architecture	40 — 3-Layer(aba) Sandwich
Topology topology	50 — Rossmann fold
Homologous superfamily homologous superfamily	300 — P-loop containing nucleotide triphosphate hydrolases

Domain ID domain_id	4u7dB03
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	10 — Arc Repressor Mutant, subunit A
Homologous superfamily homologous superfamily	10 — Winged helix-like DNA-binding domain superfamily/Winged helix DNA-binding domain

Domain ID domain_id	4u7dC01
Class class	3 — Alpha Beta
Architecture architecture	40 — 3-Layer(aba) Sandwich
Topology topology	50 — Rossmann fold
Homologous superfamily homologous superfamily	300 — P-loop containing nucleotide triphosphate hydrolases

Domain ID domain_id	4u7dC02
Class class	3 — Alpha Beta
Architecture architecture	40 — 3-Layer(aba) Sandwich
Topology topology	50 — Rossmann fold
Homologous superfamily homologous superfamily	300 — P-loop containing nucleotide triphosphate hydrolases

Domain ID domain_id	4u7dC03
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	10 — Arc Repressor Mutant, subunit A
Homologous superfamily homologous superfamily	10 — Winged helix-like DNA-binding domain superfamily/Winged helix DNA-binding domain

Domain ID domain_id	4u7dD01
Class class	3 — Alpha Beta
Architecture architecture	40 — 3-Layer(aba) Sandwich
Topology topology	50 — Rossmann fold
Homologous superfamily homologous superfamily	300 — P-loop containing nucleotide triphosphate hydrolases

Domain ID domain_id	4u7dD02
Class class	3 — Alpha Beta
Architecture architecture	40 — 3-Layer(aba) Sandwich
Topology topology	50 — Rossmann fold
Homologous superfamily homologous superfamily	300 — P-loop containing nucleotide triphosphate hydrolases

Domain ID domain_id	4u7dD03
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	10 — Arc Repressor Mutant, subunit A
Homologous superfamily homologous superfamily	10 — Winged helix-like DNA-binding domain superfamily/Winged helix DNA-binding domain

▶

Unit-cell length a length_a	55.380 Å
Unit-cell length b length_b	138.220 Å
Unit-cell length c length_c	207.581 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	90.02 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	8

Space group space_group	P 1 21 1
Space-group number int_tables_number	4
Crystal system crystal_system	—

Resolution resolution	3.400 Å
Low-resolution limit resolution_low	39.900 Å
R factor r_factor	0.2138
R_work r_work	0.2051
R_free r_free	0.2486

Structure of human RECQ-like helicase in complex with an oligonucleotide

1. Protein Identity and Related Structures Protein Identity & Related Structures

ATP-dependent DNA helicase Q1

State in the Current Structure

Other States of the Same Protein in the Database

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

4u7d__assembly_1__model_1

4u7d__assembly_1__model_1 | I(q)

4u7d__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (3)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 non-polymer

6. Fold Classification (SCOP + CATH) 12 domains

CATH v4.4 (12 domains)

7. Citations (1)

Structure of human RECQ-like helicase in complex with an oligonucleotide

1. Protein Identity and Related Structures Protein Identity & Related Structures

ATP-dependent DNA helicase Q1

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

4u7d__assembly_1__model_1

4u7d__assembly_1__model_1 | I(q)

4u7d__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (3)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 non-polymer

6. Fold Classification (SCOP + CATH) 12 domains

CATH v4.4 (12 domains)

7. Citations (1)