SAXSdb — 4ztu

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

DNA polymerase subunit gamma-1

Homo sapiens

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–DNA	Heteromer	Protein 3 DNA 2	DNA polymerase subunit gamma-2, mitochondrial × 2 （Q9UHN1） DNA (25-MER) × 1 ;DNA (5'-D(PAPAPGPAPCPGPAPGPGPGPCPCPAPGPTPGPCPCPGPTPAPC)-3') ; × 1 MAGNESIUM ION × 2 ;2',3'-DIDEOXYCYTIDINE 5'-TRIPHOSPHATE ; × 1	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	DPOG1_HUMAN
Isoform	—
PDB entities	1
Chains and sequence ranges	Author chain A； PDBConstruct 2–1211； UniProt 30–1239

DNA polymerase subunit gamma-2, mitochondrial

Homo sapiens

UniProt Q9UHN1

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–DNA	Heteromer	Protein 3 DNA 2	DNA polymerase subunit gamma-1 × 1 （P54098） DNA (25-MER) × 1 ;DNA (5'-D(PAPAPGPAPCPGPAPGPGPGPCPCPAPGPTPGPCPCPGPTPAPC)-3') ; × 1 MAGNESIUM ION × 2 ;2',3'-DIDEOXYCYTIDINE 5'-TRIPHOSPHATE ; × 1	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	DPOG2_HUMAN
Isoform	—
PDB entities	2
Chains and sequence ranges	Author chain B； PDBConstruct 2–461； UniProt 26–485 Author chain C； PDBConstruct 2–461； UniProt 26–485

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	4ztu
Deposition date deposition_date	2015-05-15
Structure title title	Structural basis for processivity and antiviral drug toxicity in human mitochondrial DNA replicase
Keywords keywords	mitochondria, DNA polymerase holoenzyme, DNA Binding Protein-DNA complex; DNA Binding Protein/DNA
Experimental Method method	X-RAY DIFFRACTION

▼

3. Official assembly/model SAXS Official SAXS Profiles

This page reads only the latest assembly calculations. Every curve maps to an explicit PDB entry, official biological assembly and coordinate model.

4ztu__assembly_1__model_1

Assembly 1 · Model 1 · CRYSOL 4.1.3-1-20251215 (887e7ef)

Download this curve (.dat)

4ztu__assembly_1__model_1 | I(q)

100 plotted points; both axes use logarithmic scales.

4ztu__assembly_1__model_1 | P(r) · Pending

P(r) will be calculated and displayed separately for the same assembly/model.

Rg（Guinier）	40.98 Å
Rg (electron density)	40.79 Å
Total Rg	41.11 Å
Atom count	14619
Residues	1749
Excluded volume	257230 Å³
Maximum q	0.500 Å⁻¹

Assembly	Model	Structure unit	Oligomeric description	Status	CRYSOL	Actions
1	1	`4ztu__assembly_1__model_1`	pentameric （5）	Success	4.1.3-1-20251215 (887e7ef)	View Download

▶

4. Crystallography and Experiment 4. Crystallography & Experiment

▶

5. Entities and Polymers Entities & Polymers (6)

Entity 1 Entity 1 polymer

Description description	DNA polymerase subunit gamma-1
Molecular weight formula_weight	138037.7 kDa
EC 编号 ec_number	2.7.7.7
Mutation mutation	D198A, E200A
Source method src_method	man
Copy count entity_count	1

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A
Atom count atom_count	14619

MVPASDPSDGQRRRQQQQQQQQQQQQQPQQPQVLSSEGGQLRHNPLDIQMLSRGLHEQIFGQGGEMPGEAAVRRSVEHLQKHGLWGQPAVPLPDVELRLPPLYGDNLDQHFRLLAQKQSLPYLEAANLLLQAQLPPKPPAWAWAEGWTRYGPEGEAVPVAIPEERALVFAVAVCLAEGTCPTLAVAISPSAWYSWCSQRLVEERYSWTSQLSPADLIPLEVPTGASSPTQRDWQEQLVVGHNVSFDRAHIREQYLIQGSRMRFLDTMSMHMAISGLSSFQRSLWIAAKQGKHKVQPPTKQGQKSQRKARRGPAISSWDWLDISSVNSLAEVHRLYVGGPPLEKEPRELFVKGTMKDIRENFQDLMQYCAQDVWATHEVFQQQLPLFLERCPHPVTLAGMLEMGVSYLPVNQNWERYLAEAQGTYEELQREMKKSLMDLANDACQLLSGERYKEDPWLWDLEWDLQEFKQKKAKKVKKEPATASKLPIEGAGAPGDPMDQEDLGPCSEEEEFQQDVMARACLQKLKGTTELLPKRPQHLPGHPGWYRKLCPRLDDPAWTPGPSLLSLQMRVTPKLMALTWDGFPLHYSERHGWGYLVPGRRDNLAKLPTGTTLESAGVVCPYRAIESLYRKHCLEQGKQQLMPQEAGLAEEFLLTDNSAIWQTVEELDYLEVEAEAKMENLRAAVPGQPLALTARGGPKDTQPSYHHGNGPYNDVDIPGCWFFKLPHKDGNSCNVGSPFAKDFLPKMEDGTLQAGPGGASGPRALEINKMISFWRNAHKRISSQMVVWLPRSALPRAVIRHPDYDEEGLYGAILPQVVTAGTITRRAVEPTWLTASNARPDRVGSELKAMVQAPPGYTLVGADVDSQELWIAAVLGDAHFAGMHGCTAFGWMTLQGRKSRGTDLHSKTATTVGISREHAKIFNYGRIYGAGQPFAERLLMQFNHRLTQQEAAEKAQQMYAATKGLRWYRLSDEGEWLVRELNLPVDRTEGGWISLQDLRKVQRETARKSQWKKWEVVAERAWKGGTESEMFNKLESIATSDIPRTPVLGCCISRALEPSAVQEEFMTSRVNWVVQSSAVDYLHLMLVAMKWLFEEFAIDGRFCISIHDEVRYLVREEDRYRAALALQITNLLTRCMFAYKLGLNDLPQSVAFFSAVDIDRCLRKEVTMDCKTPSNPTGMERRYGIPQGEALDIYQIIELTKGSLEKRSQPGPAAALEHHHHHH

Source Source

Source organism organism	Homo sapiens
Common name common_name	Human
NCBI taxonomy ID ncbi_taxonomy_id	9606
Host organism host_organism	Insect cell expression vector pTIE1

Entity 2 Entity 2 polymer

Description description	DNA polymerase subunit gamma-2, mitochondrial
Molecular weight formula_weight	53655.2 kDa
Source method src_method	man
Copy count entity_count	2

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	B,C

MDAGQPELLTERSSPKGGHVKSHAELEGNGEHPEAPGSGEGSEALLEICQRRHFLSGSKQQLSRDSLLSGCHPGFGPLGVELRKNLAAEWWTSVVVFREQVFPVDALHHKPGPLLPGDSAFRLVSAETLREILQDKELSKEQLVAFLENVLKTSGKLRENLLHGALEHYVNCLDLVNKRLPYGLAQIGVCFHPVFDTKQIRNGVKSIGEKTEASLVWFTPPRTSNQWLDFWLRHRLQWWRKFAMSPSNFSSSDCQDEEGRKGNKLYYNFPWGKELIETLWNLGDHELLHMYPGNVSKLHGRDGRKNVVPCVLSVNGDLDRGMLAYLYDSFQLTENSFTRKKNLHRKVLKLHPCLAPIKVALDVGRGPTLELRQVCQGLFNELLENGISVWPGYLETMQSSLEQLYSKYDEMSILFTVLVTETTLENGLIHLRSRDTTMKEMMHISKLKDFLIKYISSAKNVAAALEHHHHHH

Source Source

Source organism organism	Homo sapiens
Common name common_name	Human
NCBI taxonomy ID ncbi_taxonomy_id	9606
Host organism host_organism	Insect cell expression vector pTIE1

Entity 3 Entity 3 polymer

Description description	DNA (25-MER)
Molecular weight formula_weight	8235.3 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	T

GCGATACGGCACTGGCCCTCGTCTTTT

Entity 4 Entity 4 polymer

Description description	;DNA (5'-D(PAPAPGPAPCPGPAPGPGPGPCPCPAPGPTPGPCPCPGPTPAPC)-3') ;
Molecular weight formula_weight	7421.8 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	P

AAAAGACGAGGGCCAGTGCCGTAC

Entity 5 Entity 5 non-polymer

Description description	MAGNESIUM ION
Molecular weight formula_weight	24.3 kDa
Source method src_method	syn
Copy count entity_count	2

Entity 6 Entity 6 non-polymer

Description description	;2',3'-DIDEOXYCYTIDINE 5'-TRIPHOSPHATE ;
Molecular weight formula_weight	451.2 kDa
Source method src_method	syn
Copy count entity_count	1

▼

6. Fold Classification (SCOP + CATH) 4 domains

CATH v4.4 (4 domains)

Domain ID domain_id	4ztuB01
Class class	3 — Alpha Beta
Architecture architecture	30 — 2-Layer Sandwich
Topology topology	930 — BirA Bifunctional Protein; domain 2
Homologous superfamily homologous superfamily	10 — Bira Bifunctional Protein; Domain 2

Domain ID domain_id	4ztuB02
Class class	3 — Alpha Beta
Architecture architecture	40 — 3-Layer(aba) Sandwich
Topology topology	50 — Rossmann fold
Homologous superfamily homologous superfamily	800 — Anticodon-binding domain

Domain ID domain_id	4ztuC01
Class class	3 — Alpha Beta
Architecture architecture	30 — 2-Layer Sandwich
Topology topology	930 — BirA Bifunctional Protein; domain 2
Homologous superfamily homologous superfamily	10 — Bira Bifunctional Protein; Domain 2

Domain ID domain_id	4ztuC02
Class class	3 — Alpha Beta
Architecture architecture	40 — 3-Layer(aba) Sandwich
Topology topology	50 — Rossmann fold
Homologous superfamily homologous superfamily	800 — Anticodon-binding domain

▶

Unit-cell length a length_a	217.575 Å
Unit-cell length b length_b	217.575 Å
Unit-cell length c length_c	168.277 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	90.00 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	16

Space group space_group	P 41 21 2
Space-group number int_tables_number	92
Crystal system crystal_system	—

Resolution resolution	3.299 Å
Low-resolution limit resolution_low	42.670 Å
R factor r_factor	—
R_work r_work	0.3164
R_free r_free	0.3164

Structural basis for processivity and antiviral drug toxicity in human mitochondrial DNA replicase

1. Protein Identity and Related Structures Protein Identity & Related Structures

DNA polymerase subunit gamma-1

State in the Current Structure

Other States of the Same Protein in the Database

DNA polymerase subunit gamma-2, mitochondrial

State in the Current Structure

Other States of the Same Protein in the Database

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

4ztu__assembly_1__model_1

4ztu__assembly_1__model_1 | I(q)

4ztu__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (6)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Source Source

Entity 3 Entity 3 polymer

Polymer Polymer

Entity 4 Entity 4 polymer

Polymer Polymer

Entity 5 Entity 5 non-polymer

Entity 6 Entity 6 non-polymer

6. Fold Classification (SCOP + CATH) 4 domains

CATH v4.4 (4 domains)

7. Citations (1)

Structural basis for processivity and antiviral drug toxicity in human mitochondrial DNA replicase

1. Protein Identity and Related Structures Protein Identity & Related Structures

DNA polymerase subunit gamma-1

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

DNA polymerase subunit gamma-2, mitochondrial

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

4ztu__assembly_1__model_1

4ztu__assembly_1__model_1 | I(q)

4ztu__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (6)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Source Source

Entity 3 Entity 3 polymer

Polymer Polymer

Entity 4 Entity 4 polymer

Polymer Polymer

Entity 5 Entity 5 non-polymer

Entity 6 Entity 6 non-polymer

6. Fold Classification (SCOP + CATH) 4 domains

CATH v4.4 (4 domains)

7. Citations (1)