5jbg

Crystal structure of chicken LGP2 with 5'ppp 26-mer hairpin RNA with 3' GG overhang and ADP-AlF4-Mg2+ at 2.0 A resolution.

Method: X-RAY DIFFRACTION

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

LGP2

Gallus gallus

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–RNA	Monomer	Protein 1 RNA 1	;RNA (5'-R(GPPPGPAPGPCPGPUPGPCPCPGPGPGPCPAPCPGPCPUPCPCPGP*G)-3') ; × 1 ZINC ION × 1 ADENOSINE-5'-DIPHOSPHATE × 1 TETRAFLUOROALUMINATE ION × 1 MAGNESIUM ION × 1 SULFATE ION × 5 water × 2	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	G0YYQ5_CHICK
Isoform	—
PDB entities	1
Chains and sequence ranges	Author chain A； PDBConstruct 8–680； UniProt 2–674

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	5jbg
Deposition date deposition_date	2016-04-13
Structure title title	Crystal structure of chicken LGP2 with 5'ppp 26-mer hairpin RNA with 3' GG overhang and ADP-AlF4-Mg2+ at 2.0 A resolution.
Keywords keywords	Innate immune pattern recognition receptor, RIG-I like helicase, dsRNA dependent ATPase, zinc-containing CTD domain, immune system; IMMUNE SYSTEM
Experimental Method method	X-RAY DIFFRACTION

▼

3. Official assembly/model SAXS Official SAXS Profiles

This page reads only the latest assembly calculations. Every curve maps to an explicit PDB entry, official biological assembly and coordinate model.

5jbg__assembly_1__model_1

Assembly 1 · Model 1 · CRYSOL 4.1.3-1-20251215 (887e7ef)

Download this curve (.dat)

5jbg__assembly_1__model_1 | I(q)

100 plotted points; both axes use logarithmic scales.

5jbg__assembly_1__model_1 | P(r) · Pending

P(r) will be calculated and displayed separately for the same assembly/model.

Rg（Guinier）	27.22 Å
Rg (electron density)	26.65 Å
Total Rg	27.35 Å
Atom count	5855
Residues	683
Excluded volume	101310 Å³
Maximum q	0.500 Å⁻¹

Assembly	Model	Structure unit	Oligomeric description	Status	CRYSOL	Actions
1	1	`5jbg__assembly_1__model_1`	dimeric （2）	Success	4.1.3-1-20251215 (887e7ef)	View Download

▶

4. Crystallography and Experiment 4. Crystallography & Experiment

▶

5. Entities and Polymers Entities & Polymers (8)

Entity 1 Entity 1 polymer

Description description	LGP2
Molecular weight formula_weight	77459.0 kDa
Mutation mutation	GAMGGGS from tag replaces N-terminal methionine
Source method src_method	man
Copy count entity_count	1

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A
Atom count atom_count	6188

GAMGGGSELHGYQLEAVAPALRGRNSIVWLPTGAGKTRAAVHVCRRHLEGRRGGRVAVLVNKVHLVQQHLEKEFHVLRDAFKVTAVSGDSSHKCFFGQLAKGSDVVICTAQILQNALLSGEEEARVELTDFSLLVIDECHHTQKEAVYNKIMLSYLQKKLSGQRDLPQILGLTASPGTGGETSFEGAVEHILQICANLDTEVIASAQEHAQHLQSHVPQPTKQYDLCQEREQDPFGQRLKKIMAQIQEHMEMPELPQNFGTQVYEQRIVELENRAAERFCRKTRVCALHLRRYNDALLINDTVRMMDAFQCLQQFYADKRDTKDPTERFLATTFEENRATLQALAGDQRYENPRLSKLEEILQEHFQPPGSSRGIVFTKTRQSAHSLLSWLQDTAGLCGQHIRAAVLTGSGHSNQAKGMTQNEQQDVITLFRYGELNLLFSTSVAEEGLDIPECNIVVRYGLMTNEIAMVQAQGRARAQNSMYSVLAKANSREVYREQLNESLVGLMERAIRAVQAMPERKYRLKIVELQRNAVLSWQVKEARSSERRQLHDPDDVYFHCVNCNVAVCRGSDIRTVEAMHHVNINPNFRFYYTVSSGKIHFERTFRDWEPGCRIVCSECRQEWGMEMIYRNVTLPILSIKNFVVVTPDEKKKYKKWSTVTFPIEEFSYLEYCSSTQDESL

Source Source

Source organism organism	Gallus gallus
Common name common_name	Chicken
NCBI taxonomy ID ncbi_taxonomy_id	9031
Host organism host_organism	Escherichia coli BL21(DE3)

Entity 2 Entity 2 polymer

Description description	;RNA (5'-R(GPPPGPAPGPCPGPUPGPCPCPGPGPGPCPAPCPGPCPUPCPCPGP*G)-3') ;
Molecular weight formula_weight	8565.0 kDa
Mutation mutation	;5' triphosphate ;
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polyribonucleotide
Chain IDs strand_id	X

GGAGCGUGCCGUACGGCACGCUCCGG

Entity 3 Entity 3 non-polymer

Description description	ZINC ION
Molecular weight formula_weight	65.4 kDa
Source method src_method	syn
Copy count entity_count	1

Entity 4 Entity 4 non-polymer

Description description	ADENOSINE-5'-DIPHOSPHATE
Molecular weight formula_weight	427.2 kDa
Source method src_method	syn
Copy count entity_count	1

Entity 5 Entity 5 non-polymer

Description description	TETRAFLUOROALUMINATE ION
Molecular weight formula_weight	103.0 kDa
Source method src_method	syn
Copy count entity_count	1

Entity 6 Entity 6 non-polymer

Description description	MAGNESIUM ION
Molecular weight formula_weight	24.3 kDa
Source method src_method	syn
Copy count entity_count	1

Entity 7 Entity 7 non-polymer

Description description	SULFATE ION
Molecular weight formula_weight	96.1 kDa
Source method src_method	syn
Copy count entity_count	5

Entity 8 Entity 8 water

Description description	water
Molecular weight formula_weight	18.0 kDa
Source method src_method	nat
Copy count entity_count	268

▼

6. Fold Classification (SCOP + CATH) 3 domains

CATH v4.4 (3 domains)

Domain ID domain_id	5jbgA01
Class class	3 — Alpha Beta
Architecture architecture	40 — 3-Layer(aba) Sandwich
Topology topology	50 — Rossmann fold
Homologous superfamily homologous superfamily	300 — P-loop containing nucleotide triphosphate hydrolases

Domain ID domain_id	5jbgA02
Class class	1 — Mainly Alpha
Architecture architecture	20 — Up-down Bundle
Topology topology	1320 — phosphoenolpyruvate carboxylase, domain 3
Homologous superfamily homologous superfamily	30 —

Domain ID domain_id	5jbgA03
Class class	2 — Mainly Beta
Architecture architecture	170 — Beta Complex
Topology topology	150 — Metal Binding Protein, Guanine Nucleotide Exchange Factor; Chain A
Homologous superfamily homologous superfamily	30 — RIG-I-like receptor, C-terminal regulatory domain

▶

Unit-cell length a length_a	69.860 Å
Unit-cell length b length_b	97.430 Å
Unit-cell length c length_c	122.580 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	90.00 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	4

Space group space_group	P 21 21 21
Space-group number int_tables_number	19
Crystal system crystal_system	—

Resolution resolution	2.000 Å
Low-resolution limit resolution_low	76.270 Å
R factor r_factor	0.2195
R_work r_work	0.2176
R_free r_free	0.2550

Crystal structure of chicken LGP2 with 5'ppp 26-mer hairpin RNA with 3' GG overhang and ADP-AlF4-Mg2+ at 2.0 A resolution.

1. Protein Identity and Related Structures Protein Identity & Related Structures

LGP2

State in the Current Structure

Other States of the Same Protein in the Database

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

5jbg__assembly_1__model_1

5jbg__assembly_1__model_1 | I(q)

5jbg__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (8)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 non-polymer

Entity 4 Entity 4 non-polymer

Entity 5 Entity 5 non-polymer

Entity 6 Entity 6 non-polymer

Entity 7 Entity 7 non-polymer

Entity 8 Entity 8 water

6. Fold Classification (SCOP + CATH) 3 domains

CATH v4.4 (3 domains)

7. Citations (1)

Crystal structure of chicken LGP2 with 5'ppp 26-mer hairpin RNA with 3' GG overhang and ADP-AlF4-Mg2+ at 2.0 A resolution.

1. Protein Identity and Related Structures Protein Identity & Related Structures

LGP2

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

5jbg__assembly_1__model_1

5jbg__assembly_1__model_1 | I(q)

5jbg__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (8)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 non-polymer

Entity 4 Entity 4 non-polymer

Entity 5 Entity 5 non-polymer

Entity 6 Entity 6 non-polymer

Entity 7 Entity 7 non-polymer

Entity 8 Entity 8 water

6. Fold Classification (SCOP + CATH) 3 domains

CATH v4.4 (3 domains)

7. Citations (1)