SAXSdb — 5ui5

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

RNA polymerase sigma factor RpoN

Aquifex aeolicus (strain VF5)

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–DNA	Monomer	Protein 1 DNA 2	DNA (31-MER) × 1 DNA (30-MER) × 1 water × 3	Consistent with all polymers
2	Protein–DNA	Monomer	Protein 1 DNA 2	DNA (31-MER) × 1 DNA (30-MER) × 1 water × 3	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	O66858_AQUAE
Isoform	—
PDB entities	3
Chains and sequence ranges	Author chain I； PDBConstruct 5–342； UniProt 61–398 Author chain V； PDBConstruct 5–342； UniProt 61–398

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	5ui5
Deposition date deposition_date	2017-01-12
Structure title title	Crystal structure of Aquifex aeolicus sigmaN bound to promoter DNA
Keywords keywords	;Helix-turn-helix DNA binding motif winged helix-turn-helix DNA binding motif bacterial RNA polymerase sigmaN bacterial RNA polymerase sigma54, TRANSCRIPTION-DNA complex ;; TRANSCRIPTION/DNA
Experimental Method method	X-RAY DIFFRACTION

▼

3. Official assembly/model SAXS Official SAXS Profiles

This page reads only the latest assembly calculations. Every curve maps to an explicit PDB entry, official biological assembly and coordinate model.

5ui5__assembly_1__model_1

Assembly 1 · Model 1 · CRYSOL 4.1.3-1-20251215 (887e7ef)

Download this curve (.dat)

5ui5__assembly_1__model_1 | I(q)

100 plotted points; both axes use logarithmic scales.

5ui5__assembly_1__model_1 | P(r) · Pending

P(r) will be calculated and displayed separately for the same assembly/model.

Rg（Guinier）	30.26 Å
Rg (electron density)	29.41 Å
Total Rg	29.90 Å
Atom count	3854
Residues	377
Excluded volume	65255 Å³
Maximum q	0.500 Å⁻¹

Assembly	Model	Structure unit	Oligomeric description	Status	CRYSOL	Actions
1	1	`5ui5__assembly_1__model_1`	trimeric （3）	Success	4.1.3-1-20251215 (887e7ef)	View Download
2	1	`5ui5__assembly_2__model_1`	trimeric （3）	Success	4.1.3-1-20251215 (887e7ef)	View Download

▶

4. Crystallography and Experiment 4. Crystallography & Experiment

▶

5. Entities and Polymers Entities & Polymers (4)

Entity 1 Entity 1 polymer

Description description	DNA (31-MER)
Molecular weight formula_weight	9626.3 kDa
Source method src_method	syn
Copy count entity_count	2

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	A,N
Atom count atom_count	7789

GCGAAATTGGCACGAAAATTGCAATAAATAG

Entity 2 Entity 2 polymer

Description description	DNA (30-MER)
Molecular weight formula_weight	9474.1 kDa
Source method src_method	syn
Copy count entity_count	2

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	B,O

GCTATTTATTGCAATTTTCGTGCCAATTTCG

Entity 3 Entity 3 polymer

Description description	RNA polymerase sigma factor RpoN
Molecular weight formula_weight	40338.5 kDa
Source method src_method	man
Copy count entity_count	2

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	I,V

GPHMETVPYQIPYTPSELEELQQNIKLELEGKEQELALELLNYLNEKGFLSKSVEEISDVLRCSVEELEKVRQKVLRLEPLGVCSKDVWEFLELQIEEIYPEEEEILKKALRDLKRGKKLKPEIKGKLSRLRLFPLSSSAEKVYTFAKVDAIIEEENGEFFIYLYEDFIDIDLNEEYWELYKKSRNLQKELKEAFERYESIRKVLDIRRRNLRKVLEKIVERQKDFLTGKGSLKPLTLREVSSEIGIHESTLSRIVNSKYVKTPVGTYSLRTFFVRESAEGLTQGELMKLIKEIVENEDKRKPYSDQEIANILKEKGFKVARRTVAKYREMLGIPSSRERRI

Source Source

Source organism organism	Aquifex aeolicus (strain VF5)
NCBI taxonomy ID ncbi_taxonomy_id	224324
Host organism host_organism	Escherichia coli

Entity 4 Entity 4 water

Description description	water
Molecular weight formula_weight	18.0 kDa
Source method src_method	nat
Copy count entity_count	32

▼

6. Fold Classification (SCOP + CATH) 4 domains

CATH v4.4 (4 domains)

Domain ID domain_id	5ui5I01
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	10 — Arc Repressor Mutant, subunit A
Homologous superfamily homologous superfamily	1330 — RNA polymerase sigma-54 factor, core-binding domain

Domain ID domain_id	5ui5I04
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	10 — Arc Repressor Mutant, subunit A
Homologous superfamily homologous superfamily	60 — Homeodomain-like

Domain ID domain_id	5ui5V01
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	10 — Arc Repressor Mutant, subunit A
Homologous superfamily homologous superfamily	1330 — RNA polymerase sigma-54 factor, core-binding domain

Domain ID domain_id	5ui5V04
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	10 — Arc Repressor Mutant, subunit A
Homologous superfamily homologous superfamily	60 — Homeodomain-like

▶

Unit-cell length a length_a	99.921 Å
Unit-cell length b length_b	99.921 Å
Unit-cell length c length_c	123.300 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	90.00 °
Unit-cell angle γ angle_gamma	120.00 °
Molecules per unit cell Z z_pdb	6

Space group space_group	P 32
Space-group number int_tables_number	145
Crystal system crystal_system	—

Resolution resolution	3.400 Å
Low-resolution limit resolution_low	14.990 Å
R factor r_factor	0.2910
R_work r_work	0.2890
R_free r_free	0.3360

Crystal structure of Aquifex aeolicus sigmaN bound to promoter DNA

1. Protein Identity and Related Structures Protein Identity & Related Structures

RNA polymerase sigma factor RpoN

State in the Current Structure

Other States of the Same Protein in the Database

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

5ui5__assembly_1__model_1

5ui5__assembly_1__model_1 | I(q)

5ui5__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

5. Entities and Polymers Entities & Polymers (4)

Entity 1 Entity 1 polymer

Polymer Polymer

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 polymer

Polymer Polymer

Source Source

Entity 4 Entity 4 water

6. Fold Classification (SCOP + CATH) 4 domains

CATH v4.4 (4 domains)

7. Citations (1)

Crystal structure of Aquifex aeolicus sigmaN bound to promoter DNA

1. Protein Identity and Related Structures Protein Identity & Related Structures

RNA polymerase sigma factor RpoN

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

5ui5__assembly_1__model_1

5ui5__assembly_1__model_1 | I(q)

5ui5__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

5. Entities and Polymers Entities & Polymers (4)

Entity 1 Entity 1 polymer

Polymer Polymer

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 polymer

Polymer Polymer

Source Source

Entity 4 Entity 4 water

6. Fold Classification (SCOP + CATH) 4 domains

CATH v4.4 (4 domains)

7. Citations (1)