SAXSdb — 5y58

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

ATP-dependent DNA helicase II subunit 1

Saccharomyces cerevisiae (strain ATCC 204508 / S288c)

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–RNA	Heteromer	Protein 2 RNA 1	ATP-dependent DNA helicase II subunit 2 × 1 （Q04437） TLC1 × 1 water × 3	Consistent with all polymers
2	Protein–RNA	Heteromer	Protein 2 RNA 1	ATP-dependent DNA helicase II subunit 2 × 1 （Q04437） TLC1 × 1 water × 3	Consistent with all polymers
3	Protein–RNA	Heteromer	Protein 2 RNA 1	ATP-dependent DNA helicase II subunit 2 × 1 （Q04437） TLC1 × 1 water × 3	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	KU70_YEAST
Isoform	—
PDB entities	1
Chains and sequence ranges	Author chain A； PDBConstruct 1–575； UniProt 28–602 Author chain C； PDBConstruct 1–575； UniProt 28–602 Author chain E； PDBConstruct 1–575； UniProt 28–602

ATP-dependent DNA helicase II subunit 2

Saccharomyces cerevisiae (strain ATCC 204508 / S288c)

UniProt Q04437

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–RNA	Heteromer	Protein 2 RNA 1	ATP-dependent DNA helicase II subunit 1 × 1 （P32807） TLC1 × 1 water × 3	Consistent with all polymers
2	Protein–RNA	Heteromer	Protein 2 RNA 1	ATP-dependent DNA helicase II subunit 1 × 1 （P32807） TLC1 × 1 water × 3	Consistent with all polymers
3	Protein–RNA	Heteromer	Protein 2 RNA 1	ATP-dependent DNA helicase II subunit 1 × 1 （P32807） TLC1 × 1 water × 3	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	KU80_YEAST
Isoform	—
PDB entities	2
Chains and sequence ranges	Author chain B； PDBConstruct 1–628； UniProt 2–629 Author chain D； PDBConstruct 1–628； UniProt 2–629 Author chain F； PDBConstruct 1–628； UniProt 2–629

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	5y58
Deposition date deposition_date	2017-08-08
Structure title title	Crystal structure of Ku70/80 and TLC1
Keywords keywords	telomerase, telomere, protein-RNA complex, RNA BINDING PROTEIN; RNA BINDING PROTEIN
Experimental Method method	X-RAY DIFFRACTION

▼

3. Official assembly/model SAXS Official SAXS Profiles

This page reads only the latest assembly calculations. Every curve maps to an explicit PDB entry, official biological assembly and coordinate model.

5y58__assembly_1__model_1

Assembly 1 · Model 1 · CRYSOL 4.1.3-1-20251215 (887e7ef)

Download this curve (.dat)

5y58__assembly_1__model_1 | I(q)

100 plotted points; both axes use logarithmic scales.

5y58__assembly_1__model_1 | P(r) · Pending

P(r) will be calculated and displayed separately for the same assembly/model.

Rg（Guinier）	35.89 Å
Rg (electron density)	35.67 Å
Total Rg	36.08 Å
Atom count	9699
Residues	1146
Excluded volume	171310 Å³
Maximum q	0.500 Å⁻¹

Assembly	Model	Structure unit	Oligomeric description	Status	CRYSOL	Actions
1	1	`5y58__assembly_1__model_1`	trimeric （3）	Success	4.1.3-1-20251215 (887e7ef)	View Download
2	1	`5y58__assembly_2__model_1`	trimeric （3）	Success	4.1.3-1-20251215 (887e7ef)	View Download
3	1	`5y58__assembly_3__model_1`	trimeric （3）	Success	4.1.3-1-20251215 (887e7ef)	View Download

▶

4. Crystallography and Experiment 4. Crystallography & Experiment

▶

5. Entities and Polymers Entities & Polymers (4)

Entity 1 Entity 1 polymer

Description description	ATP-dependent DNA helicase II subunit 1
Molecular weight formula_weight	67709.1 kDa
EC 编号 ec_number	3.6.4.12
Source method src_method	man
Copy count entity_count	3

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A,C,E
Atom count atom_count	29320

IHEGILFCIELSETMFKESSDLEYKSPLLEILESLDELMSQLVITRPGTAIGCYFYYCNREDAKEGIYELFPLRDINATFMKKLNDLLEDLSSGRISLYDYFMFQQTGSEKQVRLSVLFTFMLDTFLEEIPGQKQLSNKRVFLFTDIDKPQEAQDIDERARLRRLTIDLFDNKVNFATFFIGYADKPFDNEFYSDILQLGSHTNENTGLDSEFDGPSTKPIDAKYIKSRILRKKEVKRIMFQCPLILDEKTNFIVGVKGYTMYTHEKAGVRYKLVYEHEDIRQEAYSKRKFLNPITGEDVTGKTVKVYPYGDLDINLSDSQDQIVMEAYTQKDAFLKIIGFRSSSKSIHYFNNIDKSSFIVPDEAKYEGSIRTLASLLKILRKKDKIAILWGKLKSNSHPSLYTLSPSSVKDYNEGFYLYRVPFLDEIRKFPSLLSYDDGSEHKLDYDNMKKVTQSIMGYFNLRDGYNPSDFKNPLLQKHYKVLHDYLLQIETTFDENETPNTKKDRMMREDDSLRKLYYIRNKILESEKSEDPIIQRLNKYVKIWNMFYKKFNDDNISIKEEKKPFDKKPKFNI

Source Source

Source organism organism	Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Common name common_name	;Baker's yeast ;
NCBI taxonomy ID ncbi_taxonomy_id	559292
Host organism host_organism	Spodoptera frugiperda

Entity 2 Entity 2 polymer

Description description	ATP-dependent DNA helicase II subunit 2
Molecular weight formula_weight	71193.6 kDa
EC 编号 ec_number	3.6.4.12
Source method src_method	man
Copy count entity_count	3

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	B,D,F

SSESTTFIVDVSPSMMKNNNVSKSMAYLEYTLLNKSKKSRKTDWISCYLANCPVSENSQEIPNVFQIQSFLAPVTTTATIGFIKRLKQYCDQHSHDSSNEGLQSMIQCLLVVSLDIKQQFQARKILKQIVVFTDNLDDLDITDEEIDLLTEELSTRIILIDCGKDTQEERKKSNWLKLVEAIPNSRIYNMNELLVEITSPATSVVKPVRVFSGELRLGADILSTQTSNPSGSMQDENCLCIKVEAFPATKAVSGLNRKTAVEVEDSQKKERYVGVKSIIEYEIHNEGNKKNVSEDDQSGSSYIPVTISKDSVTKAYRYGADYVVLPSVLVDQTVYESFPGLDLRGFLNREALPRYFLTSESSFITADTRLGCQSDLMAFSALVDVMLENRKIAVARYVSKKDSEVNMCALCPVLIEHSNINSEKKFVKSLTLCRLPFAEDERVTDFPKLLDRTTTSGVPLKKETDGHQIDELMEQFVDSMDTDELPEIPLGNYYQPIGEVTTDTTLPLPSLNKDQEENKKDPLRIPTVFVYRQQQVLLEWIHQLMINDSREFEIPELPDSLKNKISPYTHKKFDSTKLVEVLGIKKVDKLKLDSELKTELEREKIPDLETLLKRGEQHSRGSPNNSNN

Source Source

Source organism organism	Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Common name common_name	;Baker's yeast ;
NCBI taxonomy ID ncbi_taxonomy_id	559292
Host organism host_organism	Spodoptera frugiperda

Entity 3 Entity 3 polymer

Description description	TLC1
Molecular weight formula_weight	9638.8 kDa
Source method src_method	man
Copy count entity_count	3

Polymer Polymer

Polymer type type	polyribonucleotide
Chain IDs strand_id	X,Y,Z

GGACUUAUAGAUGGCUAAAAUCUGAGUCCA

Source Source

Source organism organism	Saccharomyces cerevisiae
NCBI taxonomy ID ncbi_taxonomy_id	4932
Host organism host_organism	Escherichia coli

Entity 4 Entity 4 water

Description description	water
Molecular weight formula_weight	18.0 kDa
Source method src_method	nat
Copy count entity_count	306

▼

6. Fold Classification (SCOP + CATH) 6 domains

CATH v4.4 (6 domains)

Domain ID domain_id	5y58A01
Class class	3 — Alpha Beta
Architecture architecture	40 — 3-Layer(aba) Sandwich
Topology topology	50 — Rossmann fold
Homologous superfamily homologous superfamily	410 — von Willebrand factor, type A domain

Domain ID domain_id	5y58B01
Class class	3 — Alpha Beta
Architecture architecture	40 — 3-Layer(aba) Sandwich
Topology topology	50 — Rossmann fold
Homologous superfamily homologous superfamily	410 — von Willebrand factor, type A domain

Domain ID domain_id	5y58C01
Class class	3 — Alpha Beta
Architecture architecture	40 — 3-Layer(aba) Sandwich
Topology topology	50 — Rossmann fold
Homologous superfamily homologous superfamily	410 — von Willebrand factor, type A domain

Domain ID domain_id	5y58D01
Class class	3 — Alpha Beta
Architecture architecture	40 — 3-Layer(aba) Sandwich
Topology topology	50 — Rossmann fold
Homologous superfamily homologous superfamily	410 — von Willebrand factor, type A domain

Domain ID domain_id	5y58E01
Class class	3 — Alpha Beta
Architecture architecture	40 — 3-Layer(aba) Sandwich
Topology topology	50 — Rossmann fold
Homologous superfamily homologous superfamily	410 — von Willebrand factor, type A domain

Domain ID domain_id	5y58F01
Class class	3 — Alpha Beta
Architecture architecture	40 — 3-Layer(aba) Sandwich
Topology topology	50 — Rossmann fold
Homologous superfamily homologous superfamily	410 — von Willebrand factor, type A domain

▶

Unit-cell length a length_a	116.296 Å
Unit-cell length b length_b	115.159 Å
Unit-cell length c length_c	115.847 Å
Unit-cell angle α angle_alpha	77.43 °
Unit-cell angle β angle_beta	78.48 °
Unit-cell angle γ angle_gamma	63.73 °
Molecules per unit cell Z z_pdb	3

Space group space_group	P 1
Space-group number int_tables_number	1
Crystal system crystal_system	—

Resolution resolution	2.800 Å
Low-resolution limit resolution_low	44.107 Å
R factor r_factor	0.2175
R_work r_work	0.2153
R_free r_free	0.2577

Crystal structure of Ku70/80 and TLC1

1. Protein Identity and Related Structures Protein Identity & Related Structures

ATP-dependent DNA helicase II subunit 1

State in the Current Structure

Other States of the Same Protein in the Database

ATP-dependent DNA helicase II subunit 2

State in the Current Structure

Other States of the Same Protein in the Database

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

5y58__assembly_1__model_1

5y58__assembly_1__model_1 | I(q)

5y58__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

5. Entities and Polymers Entities & Polymers (4)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Source Source

Entity 3 Entity 3 polymer

Polymer Polymer

Source Source

Entity 4 Entity 4 water

6. Fold Classification (SCOP + CATH) 6 domains

CATH v4.4 (6 domains)

7. Citations (1)

Crystal structure of Ku70/80 and TLC1

1. Protein Identity and Related Structures Protein Identity & Related Structures

ATP-dependent DNA helicase II subunit 1

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

ATP-dependent DNA helicase II subunit 2

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

5y58__assembly_1__model_1

5y58__assembly_1__model_1 | I(q)

5y58__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

5. Entities and Polymers Entities & Polymers (4)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Source Source

Entity 3 Entity 3 polymer

Polymer Polymer

Source Source

Entity 4 Entity 4 water

6. Fold Classification (SCOP + CATH) 6 domains

CATH v4.4 (6 domains)

7. Citations (1)