SAXSdb — 5ydt

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

Ribosome biogenesis protein UTP30

OrganismNot specified

State in the Current Structure

Assembly	Oligomeric State	Construct	Mutations and Modifications	Ligands, Ions and Associated Components	Method and Experimental Conditions	Structure Quality
1	Protein–RNA Heteromer Protein × 2 RNA 2 PDB declaration: tetrameric（4） Consistent with all polymer counts	Chain U5； UniProt 1–274	Not recorded	Saccharomyces cerevisiae strain ALI 308 18S ribosomal RNA gene, partial sequence × 1 ;5' ETS RNA ; × 1 Unassigned helices × 1	ELECTRON MICROSCOPY cryo-EM buffer：pH 8 cryo-EM vitrification conditions：Cryogen ETHANE	Resolution 4.50 Å

Other States of the Same Protein in the Database

Each row is a biological assembly of the same UniProt protein in another PDB entry. The “Difference from current entry” column identifies evidence-level differences; no tag means the currently parsed fields agree.

Other PDB	Difference from Current Entry 5YDT	Assembly / Oligomeric State	Construct	Mutations and Modifications	Ligands, Ions and Non-polymers	Method and Experimental Conditions	Structure Quality
5WLC The complete structure of the small subunit processome Deposited 2017-07-26	Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Insufficient information Heteromer；Protein × 67 PDB declaration: 70-meric	Chain SN 1–274（274 aa）	Not recorded	ZN ZINC ION × 1	ELECTRON MICROSCOPY cryo-EM buffer pH 7.7 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.80 Å
5WYJ Cryo-EM structure of the 90S small subunit pre-ribosome (Dhr1-depleted, Enp1-TAP, state 1) Deposited 2017-01-13	Different oligomeric state Different structure-quality metrics	Assembly 1 Protein–RNA Heteromer；Protein × 61 PDB declaration: 64-meric	Chain U5 1–274（274 aa）	Not recorded	No recorded non-water small molecule	ELECTRON MICROSCOPY cryo-EM buffer pH 8 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 8.70 Å
5WYK Cryo-EM structure of the 90S small subunit pre-ribosome (Mtr4-depleted, Enp1-TAP) Deposited 2017-01-13	Different oligomeric state Different experimental conditions	Assembly 1 Protein–RNA Heteromer；Protein × 55 PDB declaration: 58-meric	Chain U5 1–274（274 aa）	Not recorded	No recorded non-water small molecule	ELECTRON MICROSCOPY cryo-EM buffer pH 8 cryo-EM vitrification conditions Cryogen ETHANE；blot for 2 seconds before plunging	Resolution 4.50 Å
5YDU Crystal structure of Utp30 Deposited 2017-09-14	Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain A 1–274（274 aa）	Not recorded	PO4 PHOSPHATE ION × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 6.5；291 K；1.45 M tri-sodium citrate dehydrate and 0.1 M 2-(N-morpholino)ethanesulfonic acid (MES) pH 6.5	Resolution 2.65 Å R-free 0.266
5YDU Crystal structure of Utp30 Deposited 2017-09-14	Different oligomeric state Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 2 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain B 1–274（274 aa）	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 6.5；291 K；1.45 M tri-sodium citrate dehydrate and 0.1 M 2-(N-morpholino)ethanesulfonic acid (MES) pH 6.5	Resolution 2.65 Å R-free 0.266
6KE6 3.4 angstrom cryo-EM structure of yeast 90S small subunit preribosome Deposited 2019-07-03	Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–RNA Heteromer；Protein × 68 PDB declaration: 71-meric	Chain RI 1–274（274 aa）	Not recorded	ZN ZINC ION × 2 GTP GUANOSINE-5'-TRIPHOSPHATE × 1 MG MAGNESIUM ION × 1	ELECTRON MICROSCOPY cryo-EM buffer pH 7.4 cryo-EM vitrification conditions Cryogen ETHANE；wait 30s and blot 2s before plunging	Resolution 3.40 Å
6LQP Cryo-EM structure of 90S small subunit preribosomes in transition states (State A) Deposited 2020-01-14	Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–RNA Heteromer；Protein × 70 PDB declaration: 73-meric	Chain RI 1–274（274 aa）	Not recorded	ZN ZINC ION × 2 GTP GUANOSINE-5'-TRIPHOSPHATE × 1 MG MAGNESIUM ION × 1	ELECTRON MICROSCOPY cryo-EM buffer pH 7.4 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.20 Å
6LQU Cryo-EM structure of 90S small subunit preribosomes in transition states (State A1) Deposited 2020-01-14	Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–RNA Heteromer；Protein × 69 PDB declaration: 72-meric	Chain RI 1–274（274 aa）	Not recorded	ZN ZINC ION × 1 GTP GUANOSINE-5'-TRIPHOSPHATE × 1 MG MAGNESIUM ION × 1	ELECTRON MICROSCOPY cryo-EM buffer pH 7.4 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.70 Å
6ZQA Cryo-EM structure of the 90S pre-ribosome from Saccharomyces cerevisiae, state A (Poly-Ala) Deposited 2020-07-09	Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–RNA Heteromer；Protein × 57 PDB declaration: 60-meric	Chain UZ 1–274（274 aa）	Not recorded	ZN ZINC ION × 2 MG MAGNESIUM ION × 2 GTP GUANOSINE-5'-TRIPHOSPHATE × 1	ELECTRON MICROSCOPY cryo-EM buffer pH 7.4 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 4.40 Å
6ZQB Cryo-EM structure of the 90S pre-ribosome from Saccharomyces cerevisiae, state B2 Deposited 2020-07-09	Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–RNA Heteromer；Protein × 68 PDB declaration: 71-meric	Chain UZ 1–274（274 aa）	Not recorded	ZN ZINC ION × 2 GTP GUANOSINE-5'-TRIPHOSPHATE × 1	ELECTRON MICROSCOPY cryo-EM buffer pH 7.4 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.90 Å
6ZQC Cryo-EM structure of the 90S pre-ribosome from Saccharomyces cerevisiae, state Pre-A1 Deposited 2020-07-09	Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–RNA Heteromer；Protein × 68 PDB declaration: 71-meric	Chain UZ 1–274（274 aa）	Not recorded	ZN ZINC ION × 2 MG MAGNESIUM ION × 2 GTP GUANOSINE-5'-TRIPHOSPHATE × 1	ELECTRON MICROSCOPY cryo-EM buffer pH 7.4 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.80 Å
7AJT Cryo-EM structure of the 90S-exosome super-complex (state Pre-A1-exosome) Deposited 2020-09-29	Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–RNA Heteromer；Protein × 79 PDB declaration: 83-meric	Chain UZ 1–274（274 aa）	Not recorded	ZN ZINC ION × 3 MG MAGNESIUM ION × 3 GTP GUANOSINE-5'-TRIPHOSPHATE × 1	ELECTRON MICROSCOPY cryo-EM buffer pH 7.4 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 4.60 Å
7D5S Cryo-EM structure of 90S preribosome with inactive Utp24 (state A2) Deposited 2020-09-28	Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–RNA Heteromer；Protein × 55 PDB declaration: 58-meric	Chain RI 1–274（274 aa）	Not recorded	ZN ZINC ION × 1 GTP GUANOSINE-5'-TRIPHOSPHATE × 1 MG MAGNESIUM ION × 1	ELECTRON MICROSCOPY cryo-EM buffer pH 7.4 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 4.60 Å
7SUK Structure of Bfr2-Lcp5 Complex Observed in the Small Subunit Processome Isolated from R2TP-depleted Yeast Cells Deposited 2021-11-17	Different construct Different oligomeric state Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–RNA Heteromer；Protein × 67 PDB declaration: 70-meric	Chain SN 11–257（247 aa）	Not recorded	No recorded non-water small molecule	ELECTRON MICROSCOPY cryo-EM buffer pH 7.7 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.99 Å
9G33 Stalled 90S - Utp23-Krr1-deltaC3 Deposited 2024-07-11	Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–RNA Heteromer；Protein × 62 PDB declaration: 65-meric	Chain UZ 1–274（274 aa）	Not recorded	GTP GUANOSINE-5'-TRIPHOSPHATE × 1 ZN ZINC ION × 1	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.05 Å
9N6V SSU processome maturation and disassembly, State A Deposited 2025-02-05	Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–RNA Heteromer；Protein × 69 PDB declaration: 72-meric	Chain SN 1–274（274 aa）	Not recorded	MG MAGNESIUM ION × 25 ATP ADENOSINE-5'-TRIPHOSPHATE × 1 ZN ZINC ION × 2 GTP GUANOSINE-5'-TRIPHOSPHATE × 1	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.16 Å
9N6W SSU processome maturation and disassembly, State A* Deposited 2025-02-05	Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–RNA Heteromer；Protein × 69 PDB declaration: 72-meric	Chain SN 1–274（274 aa）	Not recorded	MG MAGNESIUM ION × 25 ATP ADENOSINE-5'-TRIPHOSPHATE × 1 ZN ZINC ION × 2 GTP GUANOSINE-5'-TRIPHOSPHATE × 1	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.05 Å
9N6X SSU processome maturation and disassembly, State B Deposited 2025-02-05	Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–RNA Heteromer；Protein × 69 PDB declaration: 72-meric	Chain SN 1–274（274 aa）	Not recorded	MG MAGNESIUM ION × 34 ATP ADENOSINE-5'-TRIPHOSPHATE × 1 ZN ZINC ION × 2 GTP GUANOSINE-5'-TRIPHOSPHATE × 1	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.71 Å
9N6Y SSU processome maturation and disassembly, State C Deposited 2025-02-05	Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–RNA Heteromer；Protein × 70 PDB declaration: 73-meric	Chain SN 1–274（274 aa）	Not recorded	MG MAGNESIUM ION × 34 ATP ADENOSINE-5'-TRIPHOSPHATE × 1 ZN ZINC ION × 2 GTP GUANOSINE-5'-TRIPHOSPHATE × 1	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.65 Å

18 other PDB entries and 19 assemblies. Open the comparison page and filter oligomeric states

View Construct and Data Evidence

UniProt name	RL1D1_YEAST
Isoform	—
PDB entities	1
Chains and sequence ranges	Author chain U5； PDBConstruct 1–274； UniProt 1–274

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	5ydt
Deposition date deposition_date	2017-09-14
Structure title title	Remodeled Utp30 in 90S pre-ribosome (Mtr4-depleted, Enp1-TAP)
Keywords keywords	ribosome assembly, 90S pre-ribosome, RIBOSOME; RIBOSOME
Experimental Method method	ELECTRON MICROSCOPY

▼

3. SAXS Parameters (CRYSOL theoretical calculation) 3. SAXS Parameters (CRYSOL)

Radius of gyration Rg (Guinier) rg_guinier	29.45 Å
Radius of gyration Rg (electron density) rg_electron	27.91 Å
Forward intensity I(0) i0	72903400.00
Molecular weight molecular_weight	51858.0 kDa
Excluded volume excluded_volume	58569 Å³
Envelope volume envelope_volume	90190 Å³
Hydration-shell volume shell_volume	28365 Å³
Envelope diameter envelope_diameter	105.8 Å
Shell Rg shell_rg	33.51 Å
Envelope Rg envelope_rg	28.05 Å
Shape Rg shape_rg	27.86 Å
Total Rg total_rg	28.53 Å
Total atoms total_atoms	3556
Residues n_residues	345
Spherical-harmonic order n_harmonics	20
q range q_range	— – 0.5000 Å⁻¹
Data points n_points	101
Shell type shell_type	directional
Solvent electron density solvent_density	0.3340 e/Å³
Shell contrast contrast_shell	0.0300 e/Å³
CRYSOL version crysol_version	4.1.3

▼

4. P(r) Distance Distribution (GNOM inversion) 4. P(r) Analysis (GNOM)

Maximum dimension Dmax dmax	101.0 Å
Rg (real space) rg_real	29.44 Å
Rg uncertainty (real space) rg_real_error	1.12 Å
I(0) (real space) i0_real	7.2900e+07
I(0) uncertainty (real space) i0_real_error	1.2270e+06
Rg (reciprocal space) rg_reciprocal	29.45 Å
I(0) (reciprocal space) i0_reciprocal	72900000.0000
Solution quality estimate total_estimate	0.8908
Solution quality rating solution_quality	GOOD a GOOD solution
P(r) peaks n_peaks	2
Primary peak position r_peak_primary	33.7 Å
Skewness Skewness skewness	0.275
Kurtosis Kurtosis kurtosis	-0.382
Angular range angular_range	— – 0.2700 Å⁻¹
Current regularization parameter α current_alpha	0.0000
Highest regularization parameter α highest_alpha	2885000.0000
Real-space data points n_real_points	55
GNOM version gnom_version	4.1.3
Quality Criteria quality_criteria	AN1: 0.000; Oscil: 0.868; Stabil: 1.000; Sysdev: 1.000; Positv: 1.000; Valcen: 0.983; Smooth: 0.991

▶

5. Crystallography and Experiment 5. Crystallography & Experiment

▶

6. Entities and Polymers Entities & Polymers (4)

Entity 1 Entity 1 polymer

Description description	Ribosome biogenesis protein UTP30
Molecular weight formula_weight	31668.9 kDa
Source method src_method	nat
Copy count entity_count	1

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	U5
Atom count atom_count	3556

MVESNDIIKSGLAEKALKALILQCEENPSLKNDKDIHIIINTGKKMGINRDNIPRIIPLTKYKLFKPRDLNILLITKDPSALYRETLTKDEHTSELFKEIISVKNLRRRFKGSKLTQLYKDFDLVVADYRVHHLLPEVLGSRFYHGSKKLPYMIRMSKEVKLKRQQMVEKCDPIYVRAQLRSICKNTSYIPNNDNCLSVRVGYIQKHSIPEILQNIQDTINFLTDKSKRPQGGVIKGGIISIFVKTSNSTSLPIYQFSEARENQKNEDLSDIKL

Entity 2 Entity 2 polymer

Description description	Saccharomyces cerevisiae strain ALI 308 18S ribosomal RNA gene, partial sequence
Molecular weight formula_weight	20614.2 kDa
Source method src_method	nat
Copy count entity_count	1

Polymer Polymer

Polymer type type	polyribonucleotide
Chain IDs strand_id	SA

GACGGAGCCAGCGAGUCUAACCUUGGCCGAGAGGUCUUGGUAAUCUUGUGAAACUCCGUCGUGC

Entity 3 Entity 3 polymer

Description description	;5' ETS RNA ;
Molecular weight formula_weight	6031.6 kDa
Source method src_method	nat
Copy count entity_count	1

Polymer Polymer

Polymer type type	polyribonucleotide
Chain IDs strand_id	5A

UGGGCAUCUUGCGAUUCCA

Entity 4 Entity 4 polymer

Description description	Unassigned helices
Molecular weight formula_weight	2911.6 kDa
Source method src_method	nat
Copy count entity_count	1

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	UC

XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX

▶

8. Citations (1)

▶

Unit-cell length a length_a	1.000 Å
Unit-cell length b length_b	1.000 Å
Unit-cell length c length_c	1.000 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	90.00 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	1

Space group space_group	P 1
Space-group number int_tables_number	1
Crystal system crystal_system	—

Resolution resolution	4.50 Å
Resolution测定方法 resolution_method	—
颗粒数 num_particles	73543

fit	/app/data/saxs_computation/yd/5ydt/5ydt.fit
pddf	/app/data/pr_computation/yd/5ydt/5ydt.pr.out
profile	/app/data/saxs_computation/yd/5ydt/5ydt.dat

Remodeled Utp30 in 90S pre-ribosome (Mtr4-depleted, Enp1-TAP)

1. Protein Identity and Related Structures Protein Identity & Related Structures

Ribosome biogenesis protein UTP30

State in the Current Structure

Other States of the Same Protein in the Database

SAXS scattering curve SAXS Profile

P(r) Distance Distribution P(r) Distribution

2. Structure Basics 2. Structure Basics

3. SAXS Parameters (CRYSOL theoretical calculation) 3. SAXS Parameters (CRYSOL)

4. P(r) Distance Distribution (GNOM inversion) 4. P(r) Analysis (GNOM)

5. Crystallography and Experiment 5. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

冷冻电镜 EM 3D

6. Entities and Polymers Entities & Polymers (4)

Entity 1 Entity 1 polymer

Polymer Polymer

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 polymer

Polymer Polymer

Entity 4 Entity 4 polymer

Polymer Polymer

8. Citations (1)

9. Files and Curves (10)

Files (7)

Curves (3)