SAXSdb — 6v3k

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

Chimeric Sso7d and HIV-1 integrase

Human immunodeficiency virus 1

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Insufficient information	Homooligomer	Protein 8 DNA 4	viral DNA non-transferred strand × 2 viral DNA transferred strand × 2 MAGNESIUM ION × 4 ZINC ION × 4 4-azanyl-N-[[2,4-bis(fluoranyl)phenyl]methyl]-1-oxidanyl-2-oxidanylidene-6-(5-oxidanylpentyl)-1,8-naphthyridine-3-carboxamide × 2	Consistent with all polymers
2	Insufficient information	Homooligomer	Protein 4 DNA 2	viral DNA non-transferred strand × 1 viral DNA transferred strand × 1 MAGNESIUM ION × 2 ZINC ION × 2 4-azanyl-N-[[2,4-bis(fluoranyl)phenyl]methyl]-1-oxidanyl-2-oxidanylidene-6-(5-oxidanylpentyl)-1,8-naphthyridine-3-carboxamide × 1	Consistent with all polymers
3	Insufficient information	Homooligomer	Protein 4 DNA 2	viral DNA non-transferred strand × 1 viral DNA transferred strand × 1 MAGNESIUM ION × 2 ZINC ION × 2 4-azanyl-N-[[2,4-bis(fluoranyl)phenyl]methyl]-1-oxidanyl-2-oxidanylidene-6-(5-oxidanylpentyl)-1,8-naphthyridine-3-carboxamide × 1	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	DN7D_SACS2
Isoform	—
PDB entities	1
Chains and sequence ranges	Author chain A； PDBConstruct 21–84； UniProt 1–64 Author chain B； PDBConstruct 21–84； UniProt 1–64 Author chain C； PDBConstruct 21–84； UniProt 1–64 Author chain D； PDBConstruct 21–84； UniProt 1–64

Chimeric Sso7d and HIV-1 integrase

Human immunodeficiency virus 1

UniProt Q76353

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Insufficient information	Homooligomer	Protein 8 DNA 4	viral DNA non-transferred strand × 2 viral DNA transferred strand × 2 MAGNESIUM ION × 4 ZINC ION × 4 4-azanyl-N-[[2,4-bis(fluoranyl)phenyl]methyl]-1-oxidanyl-2-oxidanylidene-6-(5-oxidanylpentyl)-1,8-naphthyridine-3-carboxamide × 2	Consistent with all polymers
2	Insufficient information	Homooligomer	Protein 4 DNA 2	viral DNA non-transferred strand × 1 viral DNA transferred strand × 1 MAGNESIUM ION × 2 ZINC ION × 2 4-azanyl-N-[[2,4-bis(fluoranyl)phenyl]methyl]-1-oxidanyl-2-oxidanylidene-6-(5-oxidanylpentyl)-1,8-naphthyridine-3-carboxamide × 1	Consistent with all polymers
3	Insufficient information	Homooligomer	Protein 4 DNA 2	viral DNA non-transferred strand × 1 viral DNA transferred strand × 1 MAGNESIUM ION × 2 ZINC ION × 2 4-azanyl-N-[[2,4-bis(fluoranyl)phenyl]methyl]-1-oxidanyl-2-oxidanylidene-6-(5-oxidanylpentyl)-1,8-naphthyridine-3-carboxamide × 1	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	Q76353_9HIV1
Isoform	—
PDB entities	1
Chains and sequence ranges	Author chain A； PDBConstruct 96–383； UniProt 1–288 Author chain B； PDBConstruct 96–383； UniProt 1–288 Author chain C； PDBConstruct 96–383； UniProt 1–288 Author chain D； PDBConstruct 96–383； UniProt 1–288

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	6v3k
Deposition date deposition_date	2019-11-25
Structure title title	Structure of HIV cleaved synaptic complex (CSC) intasome bound with magnesium and INSTI XZ419 (compound 4c)
Keywords keywords	integrase, intasome, enzyme, transposition, VIRAL PROTEIN-DNA complex; VIRAL PROTEIN/DNA
Experimental Method method	ELECTRON MICROSCOPY

▼

3. Official assembly/model SAXS Official SAXS Profiles

This page reads only the latest assembly calculations. Every curve maps to an explicit PDB entry, official biological assembly and coordinate model.

6v3k__assembly_1__model_1

Assembly 1 · Model 1 · CRYSOL 4.1.3-1-20251215 (887e7ef)

Download this curve (.dat)

6v3k__assembly_1__model_1 | I(q)

100 plotted points; both axes use logarithmic scales.

6v3k__assembly_1__model_1 | P(r) · Pending

P(r) will be calculated and displayed separately for the same assembly/model.

Rg（Guinier）	37.32 Å
Rg (electron density)	37.89 Å
Total Rg	38.21 Å
Atom count	11272
Residues	1298
Excluded volume	197190 Å³
Maximum q	0.500 Å⁻¹

Assembly	Model	Structure unit	Oligomeric description	Status	CRYSOL	Actions
1	1	`6v3k__assembly_1__model_1`	dodecameric （12）	Success	4.1.3-1-20251215 (887e7ef)	View Download
2	1	`6v3k__assembly_2__model_1`	hexameric （6）	Excluded	—	—
	Exclusion reason： Auxiliary symmetry representation; not a complete or representative biological assembly.
3	1	`6v3k__assembly_3__model_1`	hexameric （6）	Excluded	—	—
	Exclusion reason： Auxiliary symmetry representation; not a complete or representative biological assembly.

▶

4. Crystallography and Experiment 4. Crystallography & Experiment

▶

5. Entities and Polymers Entities & Polymers (6)

Entity 1 Entity 1 polymer

Description description	Chimeric Sso7d and HIV-1 integrase
Molecular weight formula_weight	42321.3 kDa
Source method src_method	man
Copy count entity_count	4

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A,B,C,D
Atom count atom_count	5657

MGSSHHHHHHSSGLVPRGSHMATVKFKYKGEEKEVDISKIKKVWRVGKMISFTYDEGGGKTGRGAVSEKDAPKELLQMLEKQKKGGGGGGGGGGGFLDGIDKAQEEHEKYHSNWRAMASDFNLPPVVAKEIVASCDKCQLKGEAMHGQVDCSPGIWQLDCTHLEGKVILVAVHVASGYIEAEVIPAETGQETAYFLLKLAGRWPVKTVHTDNGSNFTSTTVKAACWWAGIKQEFGIPYNPQSQGVIESMNKELKKIIGQVRDQAEHLKTAVQMAVFIHNFKRKGGIGGYSAGERIVDIIATDIQTKELQKQITKIQNFRVYYRDSRDPVWKGPAKLLWKGEGAVVIQDNSDIKVVPRRKAKIIRDYGKQMAGDDCVASRQDED

Source Source

Source organism organism	Human immunodeficiency virus 1
NCBI taxonomy ID ncbi_taxonomy_id	11676
Host organism host_organism	Escherichia coli

Entity 2 Entity 2 polymer

Description description	viral DNA non-transferred strand
Molecular weight formula_weight	8188.3 kDa
Source method src_method	man
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	E

ACTGCTAGAGATTTTCCCGCCCACGCT

Source Source

Source organism organism	Human immunodeficiency virus 1
NCBI taxonomy ID ncbi_taxonomy_id	11676
Host organism host_organism	Escherichia coli

Entity 3 Entity 3 polymer

Description description	viral DNA transferred strand
Molecular weight formula_weight	7773.0 kDa
Source method src_method	man
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	F

AGCGTGGGCGGGAAAATCTCTAGCA

Source Source

Source organism organism	Human immunodeficiency virus 1
NCBI taxonomy ID ncbi_taxonomy_id	11676
Host organism host_organism	Escherichia coli

Entity 4 Entity 4 non-polymer

Description description	MAGNESIUM ION
Molecular weight formula_weight	24.3 kDa
Source method src_method	syn
Copy count entity_count	2

Entity 5 Entity 5 non-polymer

Description description	ZINC ION
Molecular weight formula_weight	65.4 kDa
Source method src_method	syn
Copy count entity_count	2

Entity 6 Entity 6 non-polymer

Description description	4-azanyl-N-[[2,4-bis(fluoranyl)phenyl]methyl]-1-oxidanyl-2-oxidanylidene-6-(5-oxidanylpentyl)-1,8-naphthyridine-3-carboxamide
Molecular weight formula_weight	432.4 kDa
Source method src_method	syn
Copy count entity_count	1

▼

6. Fold Classification (SCOP + CATH) 1 domains

CATH v4.4 (1 domains)

Domain ID domain_id	6v3kD00
Class class	2 — Mainly Beta
Architecture architecture	30 — Roll
Topology topology	30 — SH3 type barrels.
Homologous superfamily homologous superfamily	10 — Integrase, C-terminal domain superfamily, retroviral

▶

Unit-cell length a length_a	1.000 Å
Unit-cell length b length_b	1.000 Å
Unit-cell length c length_c	1.000 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	90.00 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	—

Space group space_group	P 1
Space-group number int_tables_number	1
Crystal system crystal_system	—

Resolution resolution	3.400 Å
Low-resolution limit resolution_low	214.508 Å
R factor r_factor	0.5491
R_work r_work	0.5491
R_free r_free	0.5549

Resolution resolution	3.40 Å
Resolution测定Method resolution_method	—
颗粒数 num_particles	142225

Structure of HIV cleaved synaptic complex (CSC) intasome bound with magnesium and INSTI XZ419 (compound 4c)

1. Protein Identity and Related Structures Protein Identity & Related Structures

Chimeric Sso7d and HIV-1 integrase

State in the Current Structure

Other States of the Same Protein in the Database

Chimeric Sso7d and HIV-1 integrase

State in the Current Structure

Other States of the Same Protein in the Database

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

6v3k__assembly_1__model_1

6v3k__assembly_1__model_1 | I(q)

6v3k__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

冷冻电镜 EM 3D

5. Entities and Polymers Entities & Polymers (6)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Source Source

Entity 3 Entity 3 polymer

Polymer Polymer

Source Source

Entity 4 Entity 4 non-polymer

Entity 5 Entity 5 non-polymer

Entity 6 Entity 6 non-polymer

6. Fold Classification (SCOP + CATH) 1 domains

CATH v4.4 (1 domains)

7. Citations (1)

Structure of HIV cleaved synaptic complex (CSC) intasome bound with magnesium and INSTI XZ419 (compound 4c)

1. Protein Identity and Related Structures Protein Identity & Related Structures

Chimeric Sso7d and HIV-1 integrase

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

Chimeric Sso7d and HIV-1 integrase

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

6v3k__assembly_1__model_1

6v3k__assembly_1__model_1 | I(q)

6v3k__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

冷冻电镜 EM 3D

5. Entities and Polymers Entities & Polymers (6)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Source Source

Entity 3 Entity 3 polymer

Polymer Polymer

Source Source

Entity 4 Entity 4 non-polymer

Entity 5 Entity 5 non-polymer

Entity 6 Entity 6 non-polymer

6. Fold Classification (SCOP + CATH) 1 domains

CATH v4.4 (1 domains)

7. Citations (1)