SAXSdb — 6x0m

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

Histone PARylation factor 1

Homo sapiens

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–DNA	Heteromer	Protein 4 DNA 4	Poly [ADP-ribose] polymerase 2 × 2 （Q9UGN5） DNA (167-MER) × 2 DNA (167-MER) × 2	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	HPF1_HUMAN
Isoform	—
PDB entities	1
Chains and sequence ranges	Author chain O； PDBConstruct 11–356； UniProt 1–346 Author chain o； PDBConstruct 11–356； UniProt 1–346

Poly [ADP-ribose] polymerase 2

Homo sapiens

UniProt Q9UGN5

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–DNA	Heteromer	Protein 4 DNA 4	Histone PARylation factor 1 × 2 （Q9NWY4） DNA (167-MER) × 2 DNA (167-MER) × 2	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	PARP2_HUMAN
Isoform	Q9UGN5-2
PDB entities	2
Chains and sequence ranges	Author chain P； PDBConstruct 21–590； UniProt 1–570 Author chain p； PDBConstruct 21–590； UniProt 1–570

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	6x0m
Deposition date deposition_date	2020-05-16
Structure title title	Bridging of double-strand DNA break activates PARP2/HPF1 to modify chromatin
Keywords keywords	DNA repair, PARP1, PARP2, HPF1, ADP-ribosylation, chromatin, histone modifications, GENE REGULATION; GENE REGULATION
Experimental Method method	ELECTRON MICROSCOPY

▼

3. Official assembly/model SAXS Official SAXS Profiles

This page reads only the latest assembly calculations. Every curve maps to an explicit PDB entry, official biological assembly and coordinate model.

6x0m__assembly_1__model_1

Assembly 1 · Model 1 · CRYSOL 4.1.3-1-20251215 (887e7ef)

Download this curve (.dat)

6x0m__assembly_1__model_1 | I(q)

100 plotted points; both axes use logarithmic scales.

6x0m__assembly_1__model_1 | P(r) · Pending

P(r) will be calculated and displayed separately for the same assembly/model.

Rg（Guinier）	45.34 Å
Rg (electron density)	46.55 Å
Total Rg	46.31 Å
Atom count	12421
Residues	1472
Excluded volume	218610 Å³
Maximum q	0.500 Å⁻¹

Assembly	Model	Structure unit	Oligomeric description	Status	CRYSOL	Actions
1	1	`6x0m__assembly_1__model_1`	octameric （8）	Success	4.1.3-1-20251215 (887e7ef)	View Download

▶

4. Crystallography and Experiment 4. Crystallography & Experiment

▶

5. Entities and Polymers Entities & Polymers (4)

Entity 1 Entity 1 polymer

Description description	Histone PARylation factor 1
Molecular weight formula_weight	40598.3 kDa
Source method src_method	man
Copy count entity_count	2

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	O,o
Atom count atom_count	12421

MGHHHHHHGGMVGGGGKRRPGGEGPQCEKTTDVKKSKFCEADVSSDLRKEVENHYKLSLPEDFYHFWKFCEELDPEKPSDSLSASLGLQLVGPYDILAGKHKTKKKSTGLNFNLHWRFYYDPPEFQTIIIGDNKTQYHMGYFRDSPDEFPVYVGINEAKKNCIIVPNGDNVFAAVKLFLTKKLKEITDKKKINLLKNIDEKLTEAARELGYSLEQRTVKMKQRDKKVVTKTFHGAGLVVPVDKNDVGYRELPETDADLKRICKTIVEAASDEERLKAFAPIQEMMTFVQFANDECDYGMGLELGMDLFCYGSHYFHKVAGQLLPLAYNLLKRNLFAEIIEEHLANRSQENIDQLAA

Source Source

Source organism organism	Homo sapiens
Common name common_name	Human
NCBI taxonomy ID ncbi_taxonomy_id	9606
Host organism host_organism	Escherichia coli

Entity 2 Entity 2 polymer

Description description	Poly [ADP-ribose] polymerase 2
Molecular weight formula_weight	67072.5 kDa
EC 编号 ec_number	2.4.2.30,2.4.2.-
Source method src_method	man
Copy count entity_count	2

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	P,p

MGSSHHHHHHSSGLVPRGSHMAARRRRSTGGGRARALNESKRVNNGNTAPEDSSPAKKTRRCQRQESKKMPVAGGKANKDRTEDKQDESVKALLLKGKAPVDPECTAKVGKAHVYCEGNDVYDVMLNQTNLQFNNNKYYLIQLLEDDAQRNFSVWMRWGRVGKMGQHSLVACSGNLNKAKEIFQKKFLDKTKNNWEDREKFEKVPGKYDMLQMDYATNTQDEEETKKEESLKSPLKPESQLDLRVQELIKLICNVQAMEEMMMEMKYNTKKAPLGKLTVAQIKAGYQSLKKIEDCIRAGQHGRALMEACNEFYTRIPHDFGLRTPPLIRTQKELSEKIQLLEALGDIEIAIKLVKTELQSPEHPLDQHYRNLHCALRPLDHESYEFKVISQYLQSTHAPTHSDYTMTLLDLFEVEKDGEKEAFREDLHNRMLLWHGSRMSNWVGILSHGLRIAPPEAPITGYMFGKGIYFADMSSKSANYCFASRLKNTGLLLLSEVALGQCNELLEANPKAEGLLQGKHSTKGLGKMAPSSAHFVTLNGSTVPLGPASDTGILNPDGYTLNYNEYIVYNPNQVRMRYLLKVQFNFLQLW

Source Source

Source organism organism	Homo sapiens
Common name common_name	Human
NCBI taxonomy ID ncbi_taxonomy_id	9606
Host organism host_organism	Escherichia coli

Entity 3 Entity 3 polymer

Description description	DNA (167-MER)
Molecular weight formula_weight	51776.0 kDa
Source method src_method	man
Copy count entity_count	2

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	I,i

CAATACATGCACAGGATGTATATATCTGACACGTGCCTGGAGACTAGGGAGTAATCCCCTTGGCGGTTAAAACGCGGGGGACAGCGCGTACGTGCGTTTAAGCGGTGCTAGAGCTGTCTACGACCAATTGAGCGGCCTCGGCACCGGGATTCTCCAGGGCATCATAG

Source Source

Source organism organism	synthetic construct
NCBI taxonomy ID ncbi_taxonomy_id	32630
Host organism host_organism	Escherichia coli

Entity 4 Entity 4 polymer

Description description	DNA (167-MER)
Molecular weight formula_weight	51330.7 kDa
Source method src_method	man
Copy count entity_count	2

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	J,j

CTATGATGCCCTGGAGAATCCCGGTGCCGAGGCCGCTCAATTGGTCGTAGACAGCTCTAGCACCGCTTAAACGCACGTACGCGCTGTCCCCCGCGTTTTAACCGCCAAGGGGATTACTCCCTAGTCTCCAGGCACGTGTCAGATATATACATCCTGTGCATGTATTG

Source Source

Source organism organism	synthetic construct
NCBI taxonomy ID ncbi_taxonomy_id	32630
Host organism host_organism	Escherichia coli

▶

Unit-cell length a length_a	1.000 Å
Unit-cell length b length_b	1.000 Å
Unit-cell length c length_c	1.000 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	90.00 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	—

Space group space_group	P 1
Space-group number int_tables_number	1
Crystal system crystal_system	—

Resolution resolution	6.30 Å
Resolution测定Method resolution_method	—
颗粒数 num_particles	16000

Bridging of double-strand DNA break activates PARP2/HPF1 to modify chromatin

1. Protein Identity and Related Structures Protein Identity & Related Structures

Histone PARylation factor 1

State in the Current Structure

Other States of the Same Protein in the Database

Poly [ADP-ribose] polymerase 2

State in the Current Structure

Other States of the Same Protein in the Database

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

6x0m__assembly_1__model_1

6x0m__assembly_1__model_1 | I(q)

6x0m__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

冷冻电镜 EM 3D

5. Entities and Polymers Entities & Polymers (4)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Source Source

Entity 3 Entity 3 polymer

Polymer Polymer

Source Source

Entity 4 Entity 4 polymer

Polymer Polymer

Source Source

7. Citations (1)

Bridging of double-strand DNA break activates PARP2/HPF1 to modify chromatin

1. Protein Identity and Related Structures Protein Identity & Related Structures

Histone PARylation factor 1

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

Poly [ADP-ribose] polymerase 2

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

6x0m__assembly_1__model_1

6x0m__assembly_1__model_1 | I(q)

6x0m__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

冷冻电镜 EM 3D

5. Entities and Polymers Entities & Polymers (4)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Source Source

Entity 3 Entity 3 polymer

Polymer Polymer

Source Source

Entity 4 Entity 4 polymer

Polymer Polymer

Source Source

7. Citations (1)