6x0m

Bridging of double-strand DNA break activates PARP2/HPF1 to modify chromatin

Method: ELECTRON MICROSCOPY D_max: 156.0 Å Quality: GOOD

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

Histone PARylation factor 1

Homo sapiens

State in the Current Structure

Assembly	Oligomeric State	Construct	Mutations and Modifications	Ligands, Ions and Associated Components	Method and Experimental Conditions	Structure Quality
1	Protein–DNA Heteromer Protein × 4 DNA 4 PDB declaration: octameric（8） Consistent with all polymer counts	Chain O； UniProt 1–346 Chain o； UniProt 1–346	Not recorded	Poly [ADP-ribose] polymerase 2 × 2 （Q9UGN5） DNA (167-MER) × 2 DNA (167-MER) × 2	ELECTRON MICROSCOPY cryo-EM buffer：pH 7.5 cryo-EM vitrification conditions：Cryogen ETHANE	Resolution 6.30 Å

Other States of the Same Protein in the Database

Each row is a biological assembly of the same UniProt protein in another PDB entry. The “Difference from current entry” column identifies evidence-level differences; no tag means the currently parsed fields agree.

Other PDB	Difference from Current Entry 6X0M	Assembly / Oligomeric State	Construct	Mutations and Modifications	Ligands, Ions and Non-polymers	Method and Experimental Conditions	Structure Quality
6M3G Crystal structure of human HPF1 Deposited 2020-03-03	Different construct Different mutation/modification Different oligomeric state Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain A 1–346（346 aa）	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION；300 K；0.1 M Tris-pH 8.1, 0.2 M potassium acetate, 20% w/v Polyethylene glycol (PEG) 3350	Resolution 1.57 Å R-free 0.205
6M3I Crystal structure of HPF1/PARP1 complex Deposited 2020-03-03	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein heterocomplex Heteromer；Protein × 2 PDB declaration: dimeric	Chain A 1–346（346 aa）	Not recorded	UNU BENZAMIDE × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION；300 K；0.1 M Tris-pH 7.0, 0.2 M magnesium formate dehydrate, 20% w/v PEG 3350.	Resolution 1.98 Å R-free 0.206
6TX2 Human HPF1 Deposited 2020-01-13	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain A 37–346（310 aa）	Not recorded	NA SODIUM ION × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；293 K；33% glycerol ethoxylate, 0.23 M lithium citrate tribasic tetrahydrate	Resolution 2.09 Å R-free 0.207
6TX3 HPF1 bound to catalytic fragment of PARP2 Deposited 2020-01-13	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein heterocomplex Heteromer；Protein × 2 PDB declaration: dimeric	Chain A 37–346（310 aa）	Not recorded	UHB 2-[4-[(2S,3S,4R,5R)-5-(6-aminopurin-9-yl)-3,4-bis(oxidanyl)oxolan-2-yl]carbonylpiperazin-1-yl]-N-(1-oxidanylidene-2,3-dihydroisoindol-4-yl)ethanamide × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 6；293 K；0.1 M MES pH 6, 25% v/v pentaerythritol propoxylate (5/4 PO/OH)	Resolution 2.96 Å R-free 0.260
6X0L Bridging of double-strand DNA break activates PARP2/HPF1 to modify chromatin Deposited 2020-05-16	Different construct Different mutation/modification Different oligomeric state Different structure-quality metrics	Assembly 1 Protein–DNA Heteromer；Protein × 3 PDB declaration: heptameric	Chain O 1–346（346 aa）	Not recorded	No recorded non-water small molecule	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.90 Å
6X0N Bridging of double-strand DNA break activates PARP2/HPF1 to modify chromatin Deposited 2020-05-16	Different construct Different mutation/modification Different oligomeric state Different structure-quality metrics	Assembly 1 Protein–DNA Heteromer；Protein × 19 PDB declaration: 23-meric	Chain O 1–346（346 aa）	Not recorded	No recorded non-water small molecule	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 10.00 Å
9MJA PARP1 ART in complex with HPF1 and EB47 Deposited 2024-12-14	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein heterocomplex Heteromer；Protein × 2 PDB declaration: dimeric	Chain B 1–346（346 aa）	Not recorded	UHB 2-[4-[(2S,3S,4R,5R)-5-(6-aminopurin-9-yl)-3,4-bis(oxidanyl)oxolan-2-yl]carbonylpiperazin-1-yl]-N-(1-oxidanylidene-2,3-dihydroisoindol-4-yl)ethanamide × 1	ELECTRON MICROSCOPY cryo-EM buffer pH 8 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 4.30 Å

7 other PDB entries and 7 assemblies. Open the comparison page and filter oligomeric states

View Construct and Data Evidence

UniProt name	HPF1_HUMAN
Isoform	—
PDB entities	1
Chains and sequence ranges	Author chain O； PDBConstruct 11–356； UniProt 1–346 Author chain o； PDBConstruct 11–356； UniProt 1–346

Poly [ADP-ribose] polymerase 2

Homo sapiens

UniProt Q9UGN5

State in the Current Structure

Assembly	Oligomeric State	Construct	Mutations and Modifications	Ligands, Ions and Associated Components	Method and Experimental Conditions	Structure Quality
1	Protein–DNA Heteromer Protein × 4 DNA 4 PDB declaration: octameric（8） Consistent with all polymer counts	Chain P； UniProt 1–570 Chain p； UniProt 1–570	Not recorded	Histone PARylation factor 1 × 2 （Q9NWY4） DNA (167-MER) × 2 DNA (167-MER) × 2	ELECTRON MICROSCOPY cryo-EM buffer：pH 7.5 cryo-EM vitrification conditions：Cryogen ETHANE	Resolution 6.30 Å

Other States of the Same Protein in the Database

Other PDB	Difference from Current Entry 6X0M	Assembly / Oligomeric State	Construct	Mutations and Modifications	Ligands, Ions and Non-polymers	Method and Experimental Conditions	Structure Quality
3KCZ Human poly(ADP-ribose) polymerase 2, catalytic fragment in complex with an inhibitor 3-aminobenzamide Deposited 2009-10-22	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain A 235–579（345 aa） Fragment：Catalytic domain	Not recorded	3AB 3-aminobenzamide × 1 GOL GLYCEROL × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 9；277 K；22% PEG 3350, 0.1M Tris-HCl, 0.01M 3-aminobenzamide, pH 9.0, VAPOR DIFFUSION, SITTING DROP, temperature 277K	Resolution 2.00 Å R-free 0.237
3KCZ Human poly(ADP-ribose) polymerase 2, catalytic fragment in complex with an inhibitor 3-aminobenzamide Deposited 2009-10-22	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 2 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain B 235–579（345 aa） Fragment：Catalytic domain	Not recorded	3AB 3-aminobenzamide × 1 GOL GLYCEROL × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 9；277 K；22% PEG 3350, 0.1M Tris-HCl, 0.01M 3-aminobenzamide, pH 9.0, VAPOR DIFFUSION, SITTING DROP, temperature 277K	Resolution 2.00 Å R-free 0.237
3KJD Human poly(ADP-ribose) polymerase 2, catalytic fragment in complex with an inhibitor ABT-888 Deposited 2009-11-03	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain A 235–579（345 aa） Fragment：catalytic domain	Not recorded	78P (2R)-2-(7-carbamoyl-1H-benzimidazol-2-yl)-2-methylpyrrolidinium × 1 GOL GLYCEROL × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 8.5；277 K；25% PEG 3350, 0.1M Tris, 0.25M NaCl, pH 8.5, VAPOR DIFFUSION, SITTING DROP, temperature 277K	Resolution 1.95 Å R-free 0.232
3KJD Human poly(ADP-ribose) polymerase 2, catalytic fragment in complex with an inhibitor ABT-888 Deposited 2009-11-03	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 2 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain B 235–579（345 aa） Fragment：catalytic domain	Not recorded	78P (2R)-2-(7-carbamoyl-1H-benzimidazol-2-yl)-2-methylpyrrolidinium × 1 GOL GLYCEROL × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 8.5；277 K；25% PEG 3350, 0.1M Tris, 0.25M NaCl, pH 8.5, VAPOR DIFFUSION, SITTING DROP, temperature 277K	Resolution 1.95 Å R-free 0.232
4PJV Structure of PARP2 catalytic domain bound to inhibitor BMN 673 Deposited 2014-05-12	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain A 235–579（345 aa） Fragment：PARP2 HELICAL AND CATALYTIC DOMAINS (UNP residues 235-579)	Not recorded	2YQ (8S,9R)-5-fluoro-8-(4-fluorophenyl)-9-(1-methyl-1H-1,2,4-triazol-5-yl)-2,7,8,9-tetrahydro-3H-pyrido[4,3,2-de]phthalazin-3-one × 1 GOL GLYCEROL × 2	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION；pH 7.5；289 K；(W/V) POLYETHYLENE GLYCOL 3350, 333 mM SODIUM CHLORIDE.	Resolution 2.50 Å R-free 0.287
4PJV Structure of PARP2 catalytic domain bound to inhibitor BMN 673 Deposited 2014-05-12	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 2 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain B 235–579（345 aa） Fragment：PARP2 HELICAL AND CATALYTIC DOMAINS (UNP residues 235-579)	Not recorded	2YQ (8S,9R)-5-fluoro-8-(4-fluorophenyl)-9-(1-methyl-1H-1,2,4-triazol-5-yl)-2,7,8,9-tetrahydro-3H-pyrido[4,3,2-de]phthalazin-3-one × 1 GOL GLYCEROL × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION；pH 7.5；289 K；(W/V) POLYETHYLENE GLYCOL 3350, 333 mM SODIUM CHLORIDE.	Resolution 2.50 Å R-free 0.287
4TVJ HUMAN ARTD2 (PARP2) - CATALYTIC DOMAIN IN COMPLEX WITH OLAPARIB Deposited 2014-06-27	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein monomer Monomer；Protein × 1 PDB declaration: Monomeric	Chain A 235–579（345 aa）	Not recorded	09L 4-(3-{[4-(cyclopropylcarbonyl)piperazin-1-yl]carbonyl}-4-fluorobenzyl)phthalazin-1(2H)-one × 1 GOL GLYCEROL × 2	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 8.5；277 K；25% PEG3350, 0.1M Tris	Resolution 2.10 Å R-free 0.231
4TVJ HUMAN ARTD2 (PARP2) - CATALYTIC DOMAIN IN COMPLEX WITH OLAPARIB Deposited 2014-06-27	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 2 Protein monomer Monomer；Protein × 1 PDB declaration: Monomeric	Chain B 235–579（345 aa）	Not recorded	09L 4-(3-{[4-(cyclopropylcarbonyl)piperazin-1-yl]carbonyl}-4-fluorobenzyl)phthalazin-1(2H)-one × 1 GOL GLYCEROL × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 8.5；277 K；25% PEG3350, 0.1M Tris	Resolution 2.10 Å R-free 0.231
4ZZX Structure of PARP2 catalytic domain bound to an isoindolinone inhibitor Deposited 2015-04-15	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain A 223–583（361 aa） Fragment：CATALYTIC DOMAIN, UNP RESIDUES 223-583	Not recorded	FSU 2-(3-methoxypropyl)-3-oxo-2,3-dihydro-1H-isoindole-4-carboxamide × 1	X-RAY DIFFRACTION X-ray crystallization conditions 277 K；25% PEG4000, 0.2M MAGNESIUM CHLORIDE, 0.1 M TRIS PH 8.5, 277K	Resolution 1.65 Å R-free 0.244
4ZZX Structure of PARP2 catalytic domain bound to an isoindolinone inhibitor Deposited 2015-04-15	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 2 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain B 223–583（361 aa） Fragment：CATALYTIC DOMAIN, UNP RESIDUES 223-583	Not recorded	FSU 2-(3-methoxypropyl)-3-oxo-2,3-dihydro-1H-isoindole-4-carboxamide × 1	X-RAY DIFFRACTION X-ray crystallization conditions 277 K；25% PEG4000, 0.2M MAGNESIUM CHLORIDE, 0.1 M TRIS PH 8.5, 277K	Resolution 1.65 Å R-free 0.244
4ZZY Structure of human PARP2 catalytic domain bound to an isoindolinone inhibitor Deposited 2015-04-15	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain A 223–583（361 aa） Fragment：CATALYTIC DOMAIN, UNP RESIDUES 223-583	Not recorded	D7N 2-[1-(4,4-Difluorocyclohexyl)-piperidin-4-yl]-6-fluoro-3-oxo-2,3-dihydro-1H-isoindole-4-carboxamide × 1	X-RAY DIFFRACTION X-ray crystallization conditions 25% PEG4000, 0.2M MAGNESIUM CLORIDE, 0.1 M TRIS PH 8.5	Resolution 2.20 Å R-free 0.280
5D5K Crystal Structure NLS from human PARP-2 complexed with Importin alpha delta IBB Deposited 2015-08-10	Different construct Different mutation/modification Different oligomeric state Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein heterocomplex Heteromer；Protein × 2 PDB declaration: dimeric	Chain B 1–78（78 aa） Fragment：unp residues 1-78	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 5.6；295 K；0.6-0.7M sodium citrate, 0.1M sodium citrate buffer pH 5.6, and 7-10mM DTT	Resolution 1.90 Å R-free 0.171
5DSY Crystal structure of constitutively active PARP-2 Deposited 2015-09-17	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain A 348–583（236 aa） Fragment：unp residues 348-583	Not recorded	UHB 2-[4-[(2S,3S,4R,5R)-5-(6-aminopurin-9-yl)-3,4-bis(oxidanyl)oxolan-2-yl]carbonylpiperazin-1-yl]-N-(1-oxidanylidene-2,3-dihydroisoindol-4-yl)ethanamide × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 8；298 K；2.55-2.65 M NaCl and 0.1 M Tris	Resolution 2.70 Å R-free 0.248
5DSY Crystal structure of constitutively active PARP-2 Deposited 2015-09-17	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 2 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain B 348–583（236 aa） Fragment：unp residues 348-583	Not recorded	UHB 2-[4-[(2S,3S,4R,5R)-5-(6-aminopurin-9-yl)-3,4-bis(oxidanyl)oxolan-2-yl]carbonylpiperazin-1-yl]-N-(1-oxidanylidene-2,3-dihydroisoindol-4-yl)ethanamide × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 8；298 K；2.55-2.65 M NaCl and 0.1 M Tris	Resolution 2.70 Å R-free 0.248
5DSY Crystal structure of constitutively active PARP-2 Deposited 2015-09-17	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 3 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain C 348–583（236 aa） Fragment：unp residues 348-583	Not recorded	UHB 2-[4-[(2S,3S,4R,5R)-5-(6-aminopurin-9-yl)-3,4-bis(oxidanyl)oxolan-2-yl]carbonylpiperazin-1-yl]-N-(1-oxidanylidene-2,3-dihydroisoindol-4-yl)ethanamide × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 8；298 K；2.55-2.65 M NaCl and 0.1 M Tris	Resolution 2.70 Å R-free 0.248
5DSY Crystal structure of constitutively active PARP-2 Deposited 2015-09-17	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 4 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain D 348–583（236 aa） Fragment：unp residues 348-583	Not recorded	UHB 2-[4-[(2S,3S,4R,5R)-5-(6-aminopurin-9-yl)-3,4-bis(oxidanyl)oxolan-2-yl]carbonylpiperazin-1-yl]-N-(1-oxidanylidene-2,3-dihydroisoindol-4-yl)ethanamide × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 8；298 K；2.55-2.65 M NaCl and 0.1 M Tris	Resolution 2.70 Å R-free 0.248
6F1K Structure of ARTD2/PARP2 WGR domain bound to double strand DNA without 5'phosphate Deposited 2017-11-22	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: trimeric	Chain A 90–218（129 aa）	Not recorded	GOL GLYCEROL × 1 CL CHLORIDE ION × 2	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 4.9；277 K；PEG MME 5000 0.1 M Na-acetate ethylene glyco	Resolution 2.20 Å R-free 0.250
6F5B Structure of ARTD2/PARP2 WGR domain bound to double stranded DNA with 5'phosphate Deposited 2017-12-01	Different construct Different oligomeric state Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Homooligomer；Protein × 2 PDB declaration: hexameric	Chain A 90–218（129 aa） Chain B 90–218（129 aa）	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 4.5；277 K；12 % v/v Polypropylene glycol 400 0.1 M Na-acetate 3 % 2 propanol	Resolution 2.80 Å R-free 0.274
6F5F Structure of ARTD2/PARP2 WGR domain bound to double strand DNA with 5 nucleotide overhang and 5'phosphate Deposited 2017-12-01	Different construct Different oligomeric state Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Homooligomer；Protein × 2 PDB declaration: tetrameric	Chain A 90–218（129 aa） Chain C 90–218（129 aa）	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；277 K；0.2 M Na-formate 20 % PEG 3350 20 % glycerol	Resolution 2.98 Å R-free 0.275
6F5F Structure of ARTD2/PARP2 WGR domain bound to double strand DNA with 5 nucleotide overhang and 5'phosphate Deposited 2017-12-01	Different construct Different oligomeric state Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 2 Protein–DNA Homooligomer；Protein × 2 PDB declaration: tetrameric	Chain B 90–218（129 aa） Chain D 90–218（129 aa）	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；277 K；0.2 M Na-formate 20 % PEG 3350 20 % glycerol	Resolution 2.98 Å R-free 0.275
6TX3 HPF1 bound to catalytic fragment of PARP2 Deposited 2020-01-13	Different construct Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein heterocomplex Heteromer；Protein × 2 PDB declaration: dimeric	Chain B 230–253（24 aa） Chain B 348–583（236 aa）	Not recorded	UHB 2-[4-[(2S,3S,4R,5R)-5-(6-aminopurin-9-yl)-3,4-bis(oxidanyl)oxolan-2-yl]carbonylpiperazin-1-yl]-N-(1-oxidanylidene-2,3-dihydroisoindol-4-yl)ethanamide × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 6；293 K；0.1 M MES pH 6, 25% v/v pentaerythritol propoxylate (5/4 PO/OH)	Resolution 2.96 Å R-free 0.260
6USJ Structure of two nucleosomes bridged by human PARP2 Deposited 2019-10-27	Different mutation/modification Different oligomeric state Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Heteromer；Protein × 18 PDB declaration: 22-meric	Chain U 1–570（570 aa） Chain V 1–570（570 aa）	Mutation：Q112R, F113D Mutation：Q112R, F113D	No recorded non-water small molecule	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5；Buffer was pH-adjusted and filtered through a 0.22 um filter. cryo-EM vitrification conditions Cryogen ETHANE；Blot time 2s, blot force 0	Resolution 10.50 Å
6X0L Bridging of double-strand DNA break activates PARP2/HPF1 to modify chromatin Deposited 2020-05-16	Different oligomeric state Different structure-quality metrics	Assembly 1 Protein–DNA Heteromer；Protein × 3 PDB declaration: heptameric	Chain P 1–570（570 aa） Chain R 1–570（570 aa）	Not recorded	No recorded non-water small molecule	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.90 Å
6X0N Bridging of double-strand DNA break activates PARP2/HPF1 to modify chromatin Deposited 2020-05-16	Different oligomeric state Different structure-quality metrics	Assembly 1 Protein–DNA Heteromer；Protein × 19 PDB declaration: 23-meric	Chain P 1–570（570 aa） Chain R 1–570（570 aa）	Not recorded	No recorded non-water small molecule	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 10.00 Å
7AEO Human ARTD2 in complex with DNA oligonucleotides Deposited 2020-09-17	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Homooligomer；Protein × 2 PDB declaration: hexameric	Chain A 90–583（494 aa）	Not recorded	SO4 SULFATE ION × 4	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 6.5；277 K；Sample was crystallized in 0.1 M MES pH 6.5 and 1 M ammonium sulfate. Cryo solution was a mixture of 10% (v/v) glycerol, 10% (v/v) diethylene glycol, and 10% (v/v) 2-propanol with the crystallization conditions	Resolution 2.80 Å R-free 0.271
7R59 PARP2 catalytic domain in complex with OUL245 Deposited 2022-02-10	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain A 235–583（349 aa）	Not recorded	GOL GLYCEROL × 1 I5F [1,2,4]triazolo[3,4-b][1,3]benzothiazol-6-ol × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；277 K；100 mM Tris pH 9.5 and 20% PEG 3350	Resolution 2.00 Å R-free 0.238
8HE8 Human ADP-ribosyltransferase 2 (PARP2) catalytic domain bound to a quinazoline-2,4(1H,3H)-dione inhibitor Deposited 2022-11-07	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain A 231–581（351 aa）	Not recorded	GOL GLYCEROL × 1 1WI 1-[[4-fluoranyl-3-(3-oxidanylidene-4-pentan-3-yl-piperazin-1-yl)carbonyl-phenyl]methyl]quinazoline-2,4-dione × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；291 K；25% PEG-3350, 0.1 M Tris-HCl pH 8.3-8.5	Resolution 3.05 Å R-free 0.256
8HE8 Human ADP-ribosyltransferase 2 (PARP2) catalytic domain bound to a quinazoline-2,4(1H,3H)-dione inhibitor Deposited 2022-11-07	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 2 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain B 231–581（351 aa）	Not recorded	GOL GLYCEROL × 1 1WI 1-[[4-fluoranyl-3-(3-oxidanylidene-4-pentan-3-yl-piperazin-1-yl)carbonyl-phenyl]methyl]quinazoline-2,4-dione × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；291 K；25% PEG-3350, 0.1 M Tris-HCl pH 8.3-8.5	Resolution 3.05 Å R-free 0.256
8HE8 Human ADP-ribosyltransferase 2 (PARP2) catalytic domain bound to a quinazoline-2,4(1H,3H)-dione inhibitor Deposited 2022-11-07	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 3 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain C 231–581（351 aa）	Not recorded	1WI 1-[[4-fluoranyl-3-(3-oxidanylidene-4-pentan-3-yl-piperazin-1-yl)carbonyl-phenyl]methyl]quinazoline-2,4-dione × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；291 K；25% PEG-3350, 0.1 M Tris-HCl pH 8.3-8.5	Resolution 3.05 Å R-free 0.256
8HKN Mutated human ADP-ribosyltransferase 2 (PARP2) catalytic domain bound to approved drug Fluzoparib Deposited 2022-11-27	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain B 230–581（352 aa）	Mutation：T349S,L351R,S353G,P354L	GOL GLYCEROL × 1 25I Fluzoparib × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；291 K；25% PEG-3350, 0.1 M Tris-HCl pH 8.5	Resolution 2.50 Å R-free 0.261
8HKN Mutated human ADP-ribosyltransferase 2 (PARP2) catalytic domain bound to approved drug Fluzoparib Deposited 2022-11-27	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 2 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain A 230–581（352 aa）	Mutation：T349S,L351R,S353G,P354L	GOL GLYCEROL × 1 25I Fluzoparib × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；291 K；25% PEG-3350, 0.1 M Tris-HCl pH 8.5	Resolution 2.50 Å R-free 0.261
8HKO Mutated human ADP-ribosyltransferase 2 (PARP2) catalytic domain bound to Rucaparib Deposited 2022-11-27	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain A 230–581（352 aa）	Mutation：T349S,L351R,S353G,P354L	GOL GLYCEROL × 5 RPB Rucaparib × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；291 K；25% PEG-3350, 0.1 M Tris-HCl pH 8.5	Resolution 2.10 Å R-free 0.211
8HKO Mutated human ADP-ribosyltransferase 2 (PARP2) catalytic domain bound to Rucaparib Deposited 2022-11-27	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 2 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain B 230–581（352 aa）	Mutation：T349S,L351R,S353G,P354L	GOL GLYCEROL × 1 RPB Rucaparib × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；291 K；25% PEG-3350, 0.1 M Tris-HCl pH 8.5	Resolution 2.10 Å R-free 0.211
8HKS Mutated human ADP-ribosyltransferase 2 (PARP2) catalytic domain bound to Pamiparib(BGB-290) Deposited 2022-11-28	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain A 230–581（352 aa）	Mutation：T349S,L351R,S353G,P354L	GOL GLYCEROL × 2 DS9 (2R)-14-fluoro-2-methyl-6,9,10,19-tetrazapentacyclo[14.2.1.02,6.08,18.012,17]nonadeca-1(18),8,12(17),13,15-pentaen-11-one × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；291 K；25% PEG-3350, 0.1 M Tris-HCl pH 8.5	Resolution 2.80 Å R-free 0.238
8HKS Mutated human ADP-ribosyltransferase 2 (PARP2) catalytic domain bound to Pamiparib(BGB-290) Deposited 2022-11-28	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 2 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain B 230–581（352 aa）	Mutation：T349S,L351R,S353G,P354L	GOL GLYCEROL × 5 DS9 (2R)-14-fluoro-2-methyl-6,9,10,19-tetrazapentacyclo[14.2.1.02,6.08,18.012,17]nonadeca-1(18),8,12(17),13,15-pentaen-11-one × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；291 K；25% PEG-3350, 0.1 M Tris-HCl pH 8.5	Resolution 2.80 Å R-free 0.238
8HKS Mutated human ADP-ribosyltransferase 2 (PARP2) catalytic domain bound to Pamiparib(BGB-290) Deposited 2022-11-28	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 3 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain C 230–581（352 aa）	Mutation：T349S,L351R,S353G,P354L	GOL GLYCEROL × 2 DS9 (2R)-14-fluoro-2-methyl-6,9,10,19-tetrazapentacyclo[14.2.1.02,6.08,18.012,17]nonadeca-1(18),8,12(17),13,15-pentaen-11-one × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；291 K；25% PEG-3350, 0.1 M Tris-HCl pH 8.5	Resolution 2.80 Å R-free 0.238
8HKS Mutated human ADP-ribosyltransferase 2 (PARP2) catalytic domain bound to Pamiparib(BGB-290) Deposited 2022-11-28	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 4 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain D 230–581（352 aa）	Mutation：T349S,L351R,S353G,P354L	GOL GLYCEROL × 3 DS9 (2R)-14-fluoro-2-methyl-6,9,10,19-tetrazapentacyclo[14.2.1.02,6.08,18.012,17]nonadeca-1(18),8,12(17),13,15-pentaen-11-one × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；291 K；25% PEG-3350, 0.1 M Tris-HCl pH 8.5	Resolution 2.80 Å R-free 0.238
8HLJ Mutated human ADP-ribosyltransferase 2 (PARP2) catalytic domain bound to Olaparib (AZD2281) Deposited 2022-11-30	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain A 230–581（352 aa）	Mutation：T349S,L351R,S353G,P354L	09L 4-(3-{[4-(cyclopropylcarbonyl)piperazin-1-yl]carbonyl}-4-fluorobenzyl)phthalazin-1(2H)-one × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；296.5 K；25% PEG-3350, 0.1 M Tris-HCl pH 8.5	Resolution 2.24 Å R-free 0.247
8HLJ Mutated human ADP-ribosyltransferase 2 (PARP2) catalytic domain bound to Olaparib (AZD2281) Deposited 2022-11-30	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 2 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain B 230–581（352 aa）	Mutation：T349S,L351R,S353G,P354L	09L 4-(3-{[4-(cyclopropylcarbonyl)piperazin-1-yl]carbonyl}-4-fluorobenzyl)phthalazin-1(2H)-one × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；296.5 K；25% PEG-3350, 0.1 M Tris-HCl pH 8.5	Resolution 2.24 Å R-free 0.247
8HLQ Mutated human ADP-ribosyltransferase 2 (PARP2) catalytic domain bound to Niraparib (MK-4827) Deposited 2022-11-30	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain A 230–581（352 aa）	Mutation：T349S,L351R,S353G,P354L	GOL GLYCEROL × 1 3JD 2-{4-[(3S)-piperidin-3-yl]phenyl}-2H-indazole-7-carboxamide × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；291 K；25% PEG-3350, 0.1 M Tris-HCl pH 8.5	Resolution 2.70 Å R-free 0.282
8HLQ Mutated human ADP-ribosyltransferase 2 (PARP2) catalytic domain bound to Niraparib (MK-4827) Deposited 2022-11-30	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 2 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain B 230–581（352 aa）	Mutation：T349S,L351R,S353G,P354L	GOL GLYCEROL × 2 3JD 2-{4-[(3S)-piperidin-3-yl]phenyl}-2H-indazole-7-carboxamide × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；291 K；25% PEG-3350, 0.1 M Tris-HCl pH 8.5	Resolution 2.70 Å R-free 0.282
8JNY Mutated human ADP-ribosyltransferase 2 (PARP2) catalytic domain bound to a pyrazolopyrimidine carboxamide inhibitor Deposited 2023-06-06	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain A 230–581（352 aa）	Mutation：T349S,L351R,S353G,P354L	ERV 6-methylpyrazolo[1,5-a]pyrimidine-3-carboxamide × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 8.5；291 K；25% PEG-3350, 0.1 M Tris-HCl pH 8.5	Resolution 3.20 Å R-free 0.268
8JNY Mutated human ADP-ribosyltransferase 2 (PARP2) catalytic domain bound to a pyrazolopyrimidine carboxamide inhibitor Deposited 2023-06-06	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 2 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain B 230–581（352 aa）	Mutation：T349S,L351R,S353G,P354L	ERV 6-methylpyrazolo[1,5-a]pyrimidine-3-carboxamide × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 8.5；291 K；25% PEG-3350, 0.1 M Tris-HCl pH 8.5	Resolution 3.20 Å R-free 0.268
9IM8 Mutated ADP-ribosyltransferase 2 (PARP2) catalytic domain bound to a pyrimidine 2,4-diketone derivative inhibitor Deposited 2024-07-02	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain A 230–581（352 aa）	Mutation：T349S,L351R,S353G,P354L	GOL GLYCEROL × 1 A1D9M 5-ethyl-1-[[3-[(3~{R})-4-ethyl-3-(2-hydroxyethyl)piperazin-1-yl]carbonyl-4-fluoranyl-phenyl]methyl]pyrimidine-2,4-dione × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；291 K；25% PEG-3350, 0.1 M Tris-HCl pH 8.5	Resolution 2.10 Å R-free 0.241
9IM8 Mutated ADP-ribosyltransferase 2 (PARP2) catalytic domain bound to a pyrimidine 2,4-diketone derivative inhibitor Deposited 2024-07-02	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 2 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain B 230–581（352 aa）	Mutation：T349S,L351R,S353G,P354L	A1D9M 5-ethyl-1-[[3-[(3~{R})-4-ethyl-3-(2-hydroxyethyl)piperazin-1-yl]carbonyl-4-fluoranyl-phenyl]methyl]pyrimidine-2,4-dione × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；291 K；25% PEG-3350, 0.1 M Tris-HCl pH 8.5	Resolution 2.10 Å R-free 0.241
9ZQ9 Nucleosome with an SSB at SHL -2.8 in complex with the WGR domain of human PARP2, Class 1 Deposited 2025-12-18	Different construct Different mutation/modification Different oligomeric state Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Heteromer；Protein × 11 PDB declaration: 14-meric	Chain P 90–212（123 aa）	Not recorded	No recorded non-water small molecule	ELECTRON MICROSCOPY cryo-EM buffer pH 7.4 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.30 Å
9ZQA Nucleosome with an SSB at SHL -2.8 in complex with the WGR domain of human PARP2, Class 2 Deposited 2025-12-18	Different construct Different mutation/modification Different oligomeric state Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Heteromer；Protein × 11 PDB declaration: 14-meric	Chain P 90–212（123 aa）	Not recorded	No recorded non-water small molecule	ELECTRON MICROSCOPY cryo-EM buffer pH 7.4 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.28 Å
9ZQB Nucleosome with an SSB at SHL -2.8 in complex with human PARP2 and HPF1, Class 1 Deposited 2025-12-18	Different construct Different mutation/modification Different oligomeric state Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Heteromer；Protein × 11 PDB declaration: 14-meric	Chain P 90–583（494 aa）	Not recorded	No recorded non-water small molecule	ELECTRON MICROSCOPY cryo-EM buffer pH 7.4 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 2.10 Å
9ZQC Nucleosome with an SSB at SHL -2.8 in complex with human PARP2 and HPF1, Class 2 Deposited 2025-12-18	Different construct Different mutation/modification Different oligomeric state Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Heteromer；Protein × 11 PDB declaration: 14-meric	Chain P 90–583（494 aa）	Not recorded	No recorded non-water small molecule	ELECTRON MICROSCOPY cryo-EM buffer pH 7.4 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 2.37 Å

29 other PDB entries and 49 assemblies. Open the comparison page and filter oligomeric states

View Construct and Data Evidence

UniProt name	PARP2_HUMAN
Isoform	Q9UGN5-2
PDB entities	2
Chains and sequence ranges	Author chain P； PDBConstruct 21–590； UniProt 1–570 Author chain p； PDBConstruct 21–590； UniProt 1–570

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

SAXS scattering curve SAXS Profile

P(r) Distance Distribution P(r) Distribution

Download Download SAXS (.dat) P(r) (.pr.out) CIF

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	6x0m
Deposition date deposition_date	2020-05-16
Structure title title	Bridging of double-strand DNA break activates PARP2/HPF1 to modify chromatin
Keywords keywords	DNA repair, PARP1, PARP2, HPF1, ADP-ribosylation, chromatin, histone modifications, GENE REGULATION; GENE REGULATION
Experimental Method method	ELECTRON MICROSCOPY

▼

3. SAXS Parameters (CRYSOL theoretical calculation) 3. SAXS Parameters (CRYSOL)

Radius of gyration Rg (Guinier) rg_guinier	45.34 Å
Radius of gyration Rg (electron density) rg_electron	46.55 Å
Forward intensity I(0) i0	507966000.00
Molecular weight molecular_weight	177470.0 kDa
Excluded volume excluded_volume	218610 Å³
Envelope volume envelope_volume	315990 Å³
Hydration-shell volume shell_volume	59504 Å³
Envelope diameter envelope_diameter	151.3 Å
Shell Rg shell_rg	47.54 Å
Envelope Rg envelope_rg	45.30 Å
Shape Rg shape_rg	46.64 Å
Total Rg total_rg	46.31 Å
Total atoms total_atoms	12421
Residues n_residues	1472
Spherical-harmonic order n_harmonics	20
q range q_range	— – 0.5000 Å⁻¹
Data points n_points	101
Shell type shell_type	directional
Solvent electron density solvent_density	0.3340 e/Å³
Shell contrast contrast_shell	0.0300 e/Å³
CRYSOL version crysol_version	4.1.3

▼

4. P(r) Distance Distribution (GNOM inversion) 4. P(r) Analysis (GNOM)

Maximum dimension Dmax dmax	156.0 Å
Rg (real space) rg_real	45.63 Å
Rg uncertainty (real space) rg_real_error	1.48 Å
I(0) (real space) i0_real	5.0800e+08
I(0) uncertainty (real space) i0_real_error	9.3430e+06
Rg (reciprocal space) rg_reciprocal	45.34 Å
I(0) (reciprocal space) i0_reciprocal	507800000.0000
Solution quality estimate total_estimate	0.8420
Solution quality rating solution_quality	GOOD a GOOD solution
P(r) peaks n_peaks	1
Primary peak position r_peak_primary	44.6 Å
Skewness Skewness skewness	0.448
Kurtosis Kurtosis kurtosis	-0.531
Angular range angular_range	— – 0.1750 Å⁻¹
Current regularization parameter α current_alpha	0.0000
Highest regularization parameter α highest_alpha	69180000.0000
Real-space data points n_real_points	36
GNOM version gnom_version	4.1.3
Quality Criteria quality_criteria	AN1: 0.000; Oscil: 0.740; Stabil: 1.000; Sysdev: 1.000; Positv: 1.000; Valcen: 0.837; Smooth: 0.884

▶

5. Crystallography and Experiment 5. Crystallography & Experiment

▶

6. Entities and Polymers Entities & Polymers (4)

Entity 1 Entity 1 polymer

Description description	Histone PARylation factor 1
Molecular weight formula_weight	40598.3 kDa
Source method src_method	man
Copy count entity_count	2

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	O,o
Atom count atom_count	12421

MGHHHHHHGGMVGGGGKRRPGGEGPQCEKTTDVKKSKFCEADVSSDLRKEVENHYKLSLPEDFYHFWKFCEELDPEKPSDSLSASLGLQLVGPYDILAGKHKTKKKSTGLNFNLHWRFYYDPPEFQTIIIGDNKTQYHMGYFRDSPDEFPVYVGINEAKKNCIIVPNGDNVFAAVKLFLTKKLKEITDKKKINLLKNIDEKLTEAARELGYSLEQRTVKMKQRDKKVVTKTFHGAGLVVPVDKNDVGYRELPETDADLKRICKTIVEAASDEERLKAFAPIQEMMTFVQFANDECDYGMGLELGMDLFCYGSHYFHKVAGQLLPLAYNLLKRNLFAEIIEEHLANRSQENIDQLAA

来源 Source

来源生物 organism	Homo sapiens
通用名 common_name	Human
NCBI Class编号 ncbi_taxonomy_id	9606
宿主生物 host_organism	Escherichia coli

Entity 2 Entity 2 polymer

Description description	Poly [ADP-ribose] polymerase 2
Molecular weight formula_weight	67072.5 kDa
EC 编号 ec_number	2.4.2.30,2.4.2.-
Source method src_method	man
Copy count entity_count	2

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	P,p

MGSSHHHHHHSSGLVPRGSHMAARRRRSTGGGRARALNESKRVNNGNTAPEDSSPAKKTRRCQRQESKKMPVAGGKANKDRTEDKQDESVKALLLKGKAPVDPECTAKVGKAHVYCEGNDVYDVMLNQTNLQFNNNKYYLIQLLEDDAQRNFSVWMRWGRVGKMGQHSLVACSGNLNKAKEIFQKKFLDKTKNNWEDREKFEKVPGKYDMLQMDYATNTQDEEETKKEESLKSPLKPESQLDLRVQELIKLICNVQAMEEMMMEMKYNTKKAPLGKLTVAQIKAGYQSLKKIEDCIRAGQHGRALMEACNEFYTRIPHDFGLRTPPLIRTQKELSEKIQLLEALGDIEIAIKLVKTELQSPEHPLDQHYRNLHCALRPLDHESYEFKVISQYLQSTHAPTHSDYTMTLLDLFEVEKDGEKEAFREDLHNRMLLWHGSRMSNWVGILSHGLRIAPPEAPITGYMFGKGIYFADMSSKSANYCFASRLKNTGLLLLSEVALGQCNELLEANPKAEGLLQGKHSTKGLGKMAPSSAHFVTLNGSTVPLGPASDTGILNPDGYTLNYNEYIVYNPNQVRMRYLLKVQFNFLQLW

来源 Source

来源生物 organism	Homo sapiens
通用名 common_name	Human
NCBI Class编号 ncbi_taxonomy_id	9606
宿主生物 host_organism	Escherichia coli

Entity 3 Entity 3 polymer

Description description	DNA (167-MER)
Molecular weight formula_weight	51776.0 kDa
Source method src_method	man
Copy count entity_count	2

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	I,i

CAATACATGCACAGGATGTATATATCTGACACGTGCCTGGAGACTAGGGAGTAATCCCCTTGGCGGTTAAAACGCGGGGGACAGCGCGTACGTGCGTTTAAGCGGTGCTAGAGCTGTCTACGACCAATTGAGCGGCCTCGGCACCGGGATTCTCCAGGGCATCATAG

来源 Source

来源生物 organism	synthetic construct
NCBI Class编号 ncbi_taxonomy_id	32630
宿主生物 host_organism	Escherichia coli

Entity 4 Entity 4 polymer

Description description	DNA (167-MER)
Molecular weight formula_weight	51330.7 kDa
Source method src_method	man
Copy count entity_count	2

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	J,j

CTATGATGCCCTGGAGAATCCCGGTGCCGAGGCCGCTCAATTGGTCGTAGACAGCTCTAGCACCGCTTAAACGCACGTACGCGCTGTCCCCCGCGTTTTAACCGCCAAGGGGATTACTCCCTAGTCTCCAGGCACGTGTCAGATATATACATCCTGTGCATGTATTG

来源 Source

来源生物 organism	synthetic construct
NCBI Class编号 ncbi_taxonomy_id	32630
宿主生物 host_organism	Escherichia coli

▶

8. Citations (1)

▶

Unit-cell length a length_a	1.000 Å
Unit-cell length b length_b	1.000 Å
Unit-cell length c length_c	1.000 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	90.00 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	—

Space group space_group	P 1
Space-group number int_tables_number	1
Crystal system crystal_system	—

Resolution resolution	6.30 Å
Resolution测定方法 resolution_method	—
颗粒数 num_particles	16000

fit	/app/data/saxs_computation/x0/6x0m/6x0m.fit
pddf	/app/data/pr_computation/x0/6x0m/6x0m.pr.out
profile	/app/data/saxs_computation/x0/6x0m/6x0m.dat

Bridging of double-strand DNA break activates PARP2/HPF1 to modify chromatin

1. Protein Identity and Related Structures Protein Identity & Related Structures

Histone PARylation factor 1

State in the Current Structure

Other States of the Same Protein in the Database

Poly [ADP-ribose] polymerase 2

State in the Current Structure

Other States of the Same Protein in the Database

SAXS scattering curve SAXS Profile

P(r) Distance Distribution P(r) Distribution

2. Structure Basics 2. Structure Basics

3. SAXS Parameters (CRYSOL theoretical calculation) 3. SAXS Parameters (CRYSOL)

4. P(r) Distance Distribution (GNOM inversion) 4. P(r) Analysis (GNOM)

5. Crystallography and Experiment 5. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

冷冻电镜 EM 3D

6. Entities and Polymers Entities & Polymers (4)

Entity 1 Entity 1 polymer

Polymer Polymer

来源 Source

Entity 2 Entity 2 polymer

Polymer Polymer

来源 Source

Entity 3 Entity 3 polymer

Polymer Polymer

来源 Source

Entity 4 Entity 4 polymer

Polymer Polymer

来源 Source

8. Citations (1)

9. Files and Curves (10)

Files (7)

Curves (3)