SAXSdb — 7jvt

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

Repressor protein CI

Escherichia phage 186

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Insufficient information	Homooligomer	Protein 4 DNA 4	OL1 bottom × 2 OL1 top × 2 water × 6	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	RPC1_LAMBD
Isoform	—
PDB entities	1
Chains and sequence ranges	Author chain C； PDBConstruct 1–92； UniProt 1–92 Author chain D； PDBConstruct 1–92； UniProt 1–92

Repressor protein CI

Escherichia phage 186

UniProt P08707

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Insufficient information	Homooligomer	Protein 4 DNA 4	OL1 bottom × 2 OL1 top × 2 water × 6	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	RPC1_BP186
Isoform	—
PDB entities	1
Chains and sequence ranges	Author chain C； PDBConstruct 93–202； UniProt 83–192 Author chain D； PDBConstruct 93–202； UniProt 83–192

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	7jvt
Deposition date deposition_date	2020-08-23
Structure title title	Crystal structure of a lambda-186 hybrid repressor
Keywords keywords	DNA binding transcriptional regulator, GENE REGULATION, GENE REGULATION-DNA complex; GENE REGULATION/DNA
Experimental Method method	X-RAY DIFFRACTION

▼

3. Official assembly/model SAXS Official SAXS Profiles

This page reads only the latest assembly calculations. Every curve maps to an explicit PDB entry, official biological assembly and coordinate model.

7jvt__assembly_1__model_1

Assembly 1 · Model 1 · CRYSOL 4.1.3-1-20251215 (887e7ef)

Download this curve (.dat)

7jvt__assembly_1__model_1 | I(q)

100 plotted points; both axes use logarithmic scales.

7jvt__assembly_1__model_1 | P(r) · Pending

P(r) will be calculated and displayed separately for the same assembly/model.

Rg（Guinier）	39.35 Å
Rg (electron density)	37.37 Å
Total Rg	38.06 Å
Atom count	7662
Residues	870
Excluded volume	132370 Å³
Maximum q	0.500 Å⁻¹

Assembly	Model	Structure unit	Oligomeric description	Status	CRYSOL	Actions
1	1	`7jvt__assembly_1__model_1`	octameric （8）	Success	4.1.3-1-20251215 (887e7ef)	View Download

▶

4. Crystallography and Experiment 4. Crystallography & Experiment

▶

5. Entities and Polymers Entities & Polymers (4)

Entity 1 Entity 1 polymer

Description description	Repressor protein CI
Molecular weight formula_weight	23676.2 kDa
Source method src_method	man
Copy count entity_count	2

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	C,D
Atom count atom_count	3882

MSTKKKPLTQEQLEDARRLKAIYEKKKNELGLSQESVADKMGMGQSGVGALFNGINALNAYNAALLAKILKVSVEEFSPSIAREIYEMYEAVSDAKRIEGFTLSEEILKSDKQLSVDAQFFTKPLTDGMAIRSEGKIYFVDKQASLSDGLWLVDIEGAISIRELTKLPGRKLHVAGGKVPFECGIDDIKTLGRVVGVYSEVNLVPRGSHHHHHH

Source Source

Source organism organism	Escherichia phage 186
NCBI taxonomy ID ncbi_taxonomy_id	29252
Host organism host_organism	Escherichia coli BL21(DE3)

Entity 2 Entity 2 polymer

Description description	OL1 bottom
Molecular weight formula_weight	6158.0 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	E

AATACCACTGGCGGTGATAT

Entity 3 Entity 3 polymer

Description description	OL1 top
Molecular weight formula_weight	6109.0 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	F

TATATCACCGCCAGTGGTAT

Entity 4 Entity 4 water

Description description	water
Molecular weight formula_weight	18.0 kDa
Source method src_method	nat
Copy count entity_count	51

▼

6. Fold Classification (SCOP + CATH) 4 domains

CATH v4.4 (4 domains)

Domain ID domain_id	7jvtC01
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	260 — 434 Repressor (Amino-terminal Domain)
Homologous superfamily homologous superfamily	40 — lambda repressor-like DNA-binding domains

Domain ID domain_id	7jvtC02
Class class	2 — Mainly Beta
Architecture architecture	10 — Ribbon
Topology topology	109 — Umud Fragment, subunit A
Homologous superfamily homologous superfamily	10 — Umud Fragment, subunit A

Domain ID domain_id	7jvtD01
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	260 — 434 Repressor (Amino-terminal Domain)
Homologous superfamily homologous superfamily	40 — lambda repressor-like DNA-binding domains

Domain ID domain_id	7jvtD02
Class class	2 — Mainly Beta
Architecture architecture	10 — Ribbon
Topology topology	109 — Umud Fragment, subunit A
Homologous superfamily homologous superfamily	10 — Umud Fragment, subunit A

▶

Unit-cell length a length_a	177.338 Å
Unit-cell length b length_b	177.338 Å
Unit-cell length c length_c	108.607 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	90.00 °
Unit-cell angle γ angle_gamma	120.00 °
Molecules per unit cell Z z_pdb	36

Space group space_group	H 3 2
Space-group number int_tables_number	155
Crystal system crystal_system	—

Resolution resolution	3.160 Å
Low-resolution limit resolution_low	36.200 Å
R factor r_factor	0.2336
R_work r_work	0.2282
R_free r_free	0.2814

Crystal structure of a lambda-186 hybrid repressor

1. Protein Identity and Related Structures Protein Identity & Related Structures

Repressor protein CI

State in the Current Structure

Other States of the Same Protein in the Database

Repressor protein CI

State in the Current Structure

Other States of the Same Protein in the Database

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

7jvt__assembly_1__model_1

7jvt__assembly_1__model_1 | I(q)

7jvt__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (4)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 polymer

Polymer Polymer

Entity 4 Entity 4 water

6. Fold Classification (SCOP + CATH) 4 domains

CATH v4.4 (4 domains)

7. Citations (1)

Crystal structure of a lambda-186 hybrid repressor

1. Protein Identity and Related Structures Protein Identity & Related Structures

Repressor protein CI

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

Repressor protein CI

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

7jvt__assembly_1__model_1

7jvt__assembly_1__model_1 | I(q)

7jvt__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (4)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 polymer

Polymer Polymer

Entity 4 Entity 4 water

6. Fold Classification (SCOP + CATH) 4 domains

CATH v4.4 (4 domains)

7. Citations (1)