SAXSdb — 7mr3

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

RecBCD enzyme subunit RecB

Escherichia coli (strain K12)

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–DNA	Heteromer	Protein 3 DNA 2	RecBCD enzyme subunit RecC × 1 （P07648） RecBCD enzyme subunit RecD × 1 （P04993） DNA (60-MER) × 1 DNA (60-MER) × 1	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	RECB_ECOLI
Isoform	—
PDB entities	1
Chains and sequence ranges	Author chain B； PDBConstruct 1–1180； UniProt 1–1180

RecBCD enzyme subunit RecC

Escherichia coli (strain K12)

UniProt P07648

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–DNA	Heteromer	Protein 3 DNA 2	RecBCD enzyme subunit RecB × 1 （P08394） RecBCD enzyme subunit RecD × 1 （P04993） DNA (60-MER) × 1 DNA (60-MER) × 1	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	RECC_ECOLI
Isoform	—
PDB entities	2
Chains and sequence ranges	Author chain C； PDBConstruct 1–1122； UniProt 1–1122

RecBCD enzyme subunit RecD

Escherichia coli (strain K12)

UniProt P04993

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–DNA	Heteromer	Protein 3 DNA 2	RecBCD enzyme subunit RecB × 1 （P08394） RecBCD enzyme subunit RecC × 1 （P07648） DNA (60-MER) × 1 DNA (60-MER) × 1	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	RECD_ECOLI
Isoform	—
PDB entities	3
Chains and sequence ranges	Author chain D； PDBConstruct 1–608； UniProt 1–608

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	7mr3
Deposition date deposition_date	2021-05-07
Structure title title	Cryo-EM structure of RecBCD-DNA complex with docked RecBNuc and stabilized RecD
Keywords keywords	SF1 helicase, complex, DNA repair, motor protein, HYDROLASE-DNA complex; HYDROLASE/DNA
Experimental Method method	ELECTRON MICROSCOPY

▼

3. Official assembly/model SAXS Official SAXS Profiles

This page reads only the latest assembly calculations. Every curve maps to an explicit PDB entry, official biological assembly and coordinate model.

7mr3__assembly_1__model_1

Assembly 1 · Model 1 · CRYSOL 4.1.3-1-20251215 (887e7ef)

Download this curve (.dat)

7mr3__assembly_1__model_1 | I(q)

100 plotted points; both axes use logarithmic scales.

7mr3__assembly_1__model_1 | P(r) · Pending

P(r) will be calculated and displayed separately for the same assembly/model.

Rg（Guinier）	47.69 Å
Rg (electron density)	46.95 Å
Total Rg	47.23 Å
Atom count	23615
Residues	2894
Excluded volume	415850 Å³
Maximum q	0.500 Å⁻¹

Assembly	Model	Structure unit	Oligomeric description	Status	CRYSOL	Actions
1	1	`7mr3__assembly_1__model_1`	pentameric （5）	Success	4.1.3-1-20251215 (887e7ef)	View Download

▶

4. Crystallography and Experiment 4. Crystallography & Experiment

▶

5. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Description description	RecBCD enzyme subunit RecB
Molecular weight formula_weight	134110.6 kDa
EC 编号 ec_number	3.1.11.5
Source method src_method	man
Copy count entity_count	1

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	B
Atom count atom_count	23615

MSDVAETLDPLRLPLQGERLIEASAGTGKTFTIAALYLRLLLGLGGSAAFPRPLTVEELLVVTFTEAATAELRGRIRSNIHELRIACLRETTDNPLYERLLEEIDDKAQAAQWLLLAERQMDEAAVFTIHGFCQRMLNLNAFESGMLFEQQLIEDESLLRYQACADFWRRHCYPLPREIAQVVFETWKGPQALLRDINRYLQGEAPVIKAPPPDDETLASRHAQIVARIDTVKQQWRDAVGELDALIESSGIDRRKFNRSNQAKWIDKISAWAEEETNSYQLPESLEKFSQRFLEDRTKAGGETPRHPLFEAIDQLLAEPLSIRDLVITRALAEIRETVAREKRRRGELGFDDMLSRLDSALRSESGEVLAAAIRTRFPVAMIDEFQDTDPQQYRIFRRIWHHQPETALLLIGDPKQAIYAFRGADIFTYMKARSEVHAHYTLDTNWRSAPGMVNSVNKLFSQTDDAFMFREIPFIPVKSAGKNQALRFVFKGETQPAMKMWLMEGESCGVGDYQSTMAQVCAAQIRDWLQAGQRGEALLMNGDDARPVRASDISVLVRSRQEAAQVRDALTLLEIPSVYLSNRDSVFETLEAQEMLWLLQAVMTPERENTLRSALATSMMGLNALDIETLNNDEHAWDVVVEEFDGYRQIWRKRGVMPMLRALMSARNIAENLLATAGGERRLTDILHISELLQEAGTQLESEHALVRWLSQHILEPDSNASSQQMRLESDKHLVQIVTIHKSKGLEYPLVWLPFITNFRVQEQAFYHDRHSFEAVLDLNAAPESVDLAEAERLAEDLRLLYVALTRSVWHCSLGVAPLVRRRGDKKGDTDVHQSALGRLLQKGEPQDAAGLRTCIEALCDDDIAWQTAQTGDNQPWQVNDVSTAELNAKTLQRLPGDNWRVTSYSGLQQRGHGIAQDLMPRLDVDAAGVASVVEEPTLTPHQFPRGASPGTFLHSLFEDLDFTQPVDPNWVREKLELGGFESQWEPVLTEWITAVLQAPLNETGVSLSQLSARNKQVEMEFYLPISEPLIASQLDTLIRQFDPLSAGCPPLEFMQVRGMLKGFIDLVFRHEGRYYLLDYKSNWLGEDSSAYTQQAMAAAMQAHRYDLQYQLYTLALHRYLRHRIADYDYEHHFGGVIYLFLRGVDKEHPQQGIYTTRPNAGLIALMDEMFAGMTLEEA

Source Source

Source organism organism	Escherichia coli (strain K12)
NCBI taxonomy ID ncbi_taxonomy_id	83333
Host organism host_organism	Escherichia coli

Entity 2 Entity 2 polymer

Description description	RecBCD enzyme subunit RecC
Molecular weight formula_weight	128974.1 kDa
EC 编号 ec_number	3.1.11.5
Source method src_method	man
Copy count entity_count	1

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	C

MLRVYHSNRLDVLEALMEFIVERERLDDPFEPEMILVQSTGMAQWLQMTLSQKFGIAANIDFPLPASFIWDMFVRVLPEIPKESAFNKQSMSWKLMTLLPQLLEREDFTLLRHYLTDDSDKRKLFQLSSKAADLFDQYLVYRPDWLAQWETGHLVEGLGEAQAWQAPLWKALVEYTHQLGQPRWHRANLYQRFIETLESATTCPPGLPSRVFICGISALPPVYLQALQALGKHIEIHLLFTNPCRYYWGDIKDPAYLAKLLTRQRRHSFEDRELPLFRDSENAGQLFNSDGEQDVGNPLLASWGKLGRDYIYLLSDLESSQELDAFVDVTPDNLLHNIQSDILELENRAVAGVNIEEFSRSDNKRPLDPLDSSITFHVCHSPQREVEVLHDRLLAMLEEDPTLTPRDIIVMVADIDSYSPFIQAVFGSAPADRYLPYAISDRRARQSHPVLEAFISLLSLPDSRFVSEDVLALLDVPVLAARFDITEEGLRYLRQWVNESGIRWGIDDDNVRELELPATGQHTWRFGLTRMLLGYAMESAQGEWQSVLPYDESSGLIAELVGHLASLLMQLNIWRRGLAQERPLEEWLPVCRDMLNAFFLPDAETEAAMTLIEQQWQAIIAEGLGAQYGDAVPLSLLRDELAQRLDQERISQRFLAGPVNICTLMPMRSIPFKVVCLLGMNDGVYPRQLAPLGFDLMSQKPKRGDRSRRDDDRYLFLEALISAQQKLYISYIGRSIQDNSERFPSVLVQELIDYIGQSHYLPGDEALNCDESEARVKAHLTCLHTRMPFDPQNYQPGERQSYAREWLPAASQAGKAHSEFVQPLPFTLPETVPLETLQRFWAHPVRAFFQMRLQVNFRTEDSEIPDTEPFILEGLSRYQINQQLLNALVEQDDAERLFRRFRAAGDLPYGAFGEIFWETQCQEMQQLADRVIACRQPGQSMEIDLACNGVQITGWLPQVQPDGLLRWRPSLLSVAQGMQLWLEHLVYCASGGNGESRLFLRKDGEWRFPPLAAEQALHYLSQLIEGYREGMSAPLLVLPESGGAWLKTCYDAQNDAMLDDDSTLQKARTKFLQAYEGNMMVRGEGDDIWYQRLWRQLTPETMEAIVEQSQRFLLPLFRFNQS

Source Source

Source organism organism	Escherichia coli (strain K12)
NCBI taxonomy ID ncbi_taxonomy_id	83333
Host organism host_organism	Escherichia coli

Entity 3 Entity 3 polymer

Description description	RecBCD enzyme subunit RecD
Molecular weight formula_weight	66990.4 kDa
EC 编号 ec_number	3.1.11.5
Source method src_method	man
Copy count entity_count	1

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	D

MKLQKQLLEAVEHKQLRPLDVQFALTVAGDEHPAVTLAAALLSHDAGEGHVCLPLSRLENNEASHPLLATCVSEIGELQNWEECLLASQAVSRGDEPTPMILCGDRLYLNRMWCNERTVARFFNEVNHAIEVDEALLAQTLDKLFPVSDEINWQKVAAAVALTRRISVISGGPGTGKTTTVAKLLAALIQMADGERCRIRLAAPTGKAAARLTESLGKALRQLPLTDEQKKRIPEDASTLHRLLGAQPGSQRLRHHAGNPLHLDVLVVDEASMIDLPMMSRLIDALPDHARVIFLGDRDQLASVEAGAVLGDICAYANAGFTAERARQLSRLTGTHVPAGTGTEAASLRDSLCLLQKSYRFGSDSGIGQLAAAINRGDKTAVKTVFQQDFTDIEKRLLQSGEDYIAMLEEALAGYGRYLDLLQARAEPDLIIQAFNEYQLLCALREGPFGVAGLNERIEQFMQQKRKIHRHPHSRWYEGRPVMIARNDSALGLFNGDIGIALDRGQGTRVWFAMPDGNIKSVQPSRLPEHETTWAMTVHKSQGSEFDHAALILPSQRTPVVTRELVYTAVTRARRRLSLYADERILSAAIATRTERRSGLAALFSSRE

Source Source

Source organism organism	Escherichia coli (strain K12)
NCBI taxonomy ID ncbi_taxonomy_id	83333
Host organism host_organism	Escherichia coli

Entity 4 Entity 4 polymer

Description description	DNA (60-MER)
Molecular weight formula_weight	18482.8 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	X

CTGGAGCATAAGATCCTAGTTTCATCCTTTAGGCTACTGCAGCTAGCTCAGGAGCCATGG

Entity 5 Entity 5 polymer

Description description	DNA (60-MER)
Molecular weight formula_weight	18500.9 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	A

CCATGGCTCCTGAGCTAGCTGCAGTAGCCTAAAGGATGAAACTAGGATCTTATGCTCCAG

▶

Unit-cell length a length_a	1.000 Å
Unit-cell length b length_b	1.000 Å
Unit-cell length c length_c	1.000 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	90.00 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	—

Space group space_group	P 1
Space-group number int_tables_number	1
Crystal system crystal_system	—

Resolution resolution	3.60 Å
Resolution测定Method resolution_method	—
颗粒数 num_particles	45202

Cryo-EM structure of RecBCD-DNA complex with docked RecBNuc and stabilized RecD

1. Protein Identity and Related Structures Protein Identity & Related Structures

RecBCD enzyme subunit RecB

State in the Current Structure

Other States of the Same Protein in the Database

RecBCD enzyme subunit RecC

State in the Current Structure

Other States of the Same Protein in the Database

RecBCD enzyme subunit RecD

State in the Current Structure

Other States of the Same Protein in the Database

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

7mr3__assembly_1__model_1

7mr3__assembly_1__model_1 | I(q)

7mr3__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

冷冻电镜 EM 3D

5. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Source Source

Entity 3 Entity 3 polymer

Polymer Polymer

Source Source

Entity 4 Entity 4 polymer

Polymer Polymer

Entity 5 Entity 5 polymer

Polymer Polymer

7. Citations (1)

Cryo-EM structure of RecBCD-DNA complex with docked RecBNuc and stabilized RecD

1. Protein Identity and Related Structures Protein Identity & Related Structures

RecBCD enzyme subunit RecB

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

RecBCD enzyme subunit RecC

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

RecBCD enzyme subunit RecD

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

7mr3__assembly_1__model_1

7mr3__assembly_1__model_1 | I(q)

7mr3__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

冷冻电镜 EM 3D

5. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Source Source

Entity 3 Entity 3 polymer

Polymer Polymer

Source Source

Entity 4 Entity 4 polymer

Polymer Polymer

Entity 5 Entity 5 polymer

Polymer Polymer

7. Citations (1)