7orl

La Crosse virus polymerase at transcription initiation stage

Method: ELECTRON MICROSCOPY

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

RNA-directed RNA polymerase L

La Crosse virus

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–RNA	Monomer	Protein 1 RNA 3	;RNA (5'-D((GTG))-R(PAPAPUPAPCPUPAPUPAPGPUPA)-3') ; × 1 ;RNA (5'-R(PAPCPGPAPGPUPGPUPCPGPUPAPCPCPAPAPG)-3') ; × 1 ;RNA (5'-R(PCPUPUPGPGPUPAPGPUPAPCPAPCPUPAPCP*U)-3') ; × 1 7-METHYL-GUANOSINE-5'-TRIPHOSPHATE-5'-GUANOSINE × 1 MAGNESIUM ION × 1 PYROPHOSPHATE 2- × 1 ZINC ION × 1	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	L_BUNLC
Isoform	—
PDB entities	2
Chains and sequence ranges	Author chain A； PDBConstruct 1–2276； UniProt 1–2263

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	7orl
Deposition date deposition_date	2021-06-06
Structure title title	La Crosse virus polymerase at transcription initiation stage
Keywords keywords	RNA-dependent RNA polymerase, VIRAL PROTEIN; VIRAL PROTEIN
Experimental Method method	ELECTRON MICROSCOPY

▼

3. Official assembly/model SAXS Official SAXS Profiles

This page reads only the latest assembly calculations. Every curve maps to an explicit PDB entry, official biological assembly and coordinate model.

7orl__assembly_1__model_1

Assembly 1 · Model 1 · CRYSOL 4.1.3-1-20251215 (887e7ef)

Download this curve (.dat)

7orl__assembly_1__model_1 | I(q)

100 plotted points; both axes use logarithmic scales.

7orl__assembly_1__model_1 | P(r) · Pending

P(r) will be calculated and displayed separately for the same assembly/model.

Rg（Guinier）	41.51 Å
Rg (electron density)	40.99 Å
Total Rg	41.38 Å
Atom count	18852
Residues	2229
Excluded volume	334220 Å³
Maximum q	0.500 Å⁻¹

Assembly	Model	Structure unit	Oligomeric description	Status	CRYSOL	Actions
1	1	`7orl__assembly_1__model_1`	tetrameric （4）	Success	4.1.3-1-20251215 (887e7ef)	View Download

▶

4. Crystallography and Experiment 4. Crystallography & Experiment

▶

5. Entities and Polymers Entities & Polymers (8)

Entity 1 Entity 1 polymer

Description description	;RNA (5'-D((GTG))-R(PAPAPUPAPCPUPAPUPAPGPUP*A)-3') ;
Molecular weight formula_weight	4785.9 kDa
Source method src_method	man
Copy count entity_count	1

Polymer Polymer

Polymer type type	polyribonucleotide
Chain IDs strand_id	P
Atom count atom_count	18852

AAUGCUAUAAUAGUA

Source Source

Source organism organism	La Crosse virus
NCBI taxonomy ID ncbi_taxonomy_id	11577
Host organism host_organism	Trichoplusia ni

Entity 2 Entity 2 polymer

Description description	RNA-directed RNA polymerase L
Molecular weight formula_weight	264751.1 kDa
EC 编号 ec_number	2.7.7.48,3.1.-.-
Mutation mutation	H34K
Source method src_method	man
Copy count entity_count	1

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A

MDYQEYQQFLARINTARDACVAKDIDVDLLMARKDYFGRELCKSLNIEYRNDVPFIDIILDIRPEVDPLTIDAPHITPDNYLYINNVLYIIDYKVSVSNESSVITYDKYYELTRDISDRLSIPIEIVIIRIDPVSRDLHINSDRFKELYPTIVVDINFNQFFDLKQLLYEKFGDDEEFLLKVAHGDFTLTAPWCKTGCPEFWKHPIYKEFKMSMPVPERRLFEESVKFNAYESERWNTNLVKIREYTKKDYSEHISKSAKNIFLASGFYKQPNKNEISEGWTLMVERVQDQREISKSLHDQKPSIHFIWGAHNPGNSNNATFKLILLSKSLQSIKGISTYTEAFKSLGKMMDIGDKAIEYEEFCMSLKSKARSSWKQIMNKKLEPKQINNALVLWEQQFMINNDLIDKSEKLKLFKNFCGIGKHKQFKNKMLEDLEVSKPKILDFDDANMYLASLTMMEQSKKILSKSNGLKPDNFILNEFGSRIKDANKETYDNMHKIFETGYWQCISDFSTLMKNILSVSQYNRHNTFRIAMCANNNVFAIVFPSADIKTKKATVVYSIIVLHKEEENIFNPGCLHGTFKCMNGYISISRAIRLDKERCQRIVSSPGLFLTTCLLFKHDNPTLVMSDIMNFSIYTSLSITKSVLSLTEPARYMIMNSLAISSNVKDYIAEKFSPYTKTLFSVYMTRLIKNACFDAYDQRQRVQLRDIYLSDYDITQKGIKDNRELTSIWFPGSVTLKEYLTQIYLPFYFNAKGLHEKHHVMVDLAKTILEIECEQRENIKEIWSTNCTKQTVNLKILIHSLCKNLLADTSRHNHLRNRIENRNNFRRSITTISTFTSSKSCLKIGDFRKEKELQSVKQKKILEVQSRKMRLANPMFVTDEQVCLEVGHCNYEMLRNAMPNYTDYISTKVFDRLYELLDKKVLTDKPVIEQIMDMMIDHKKFYFTFFNKGQKTSKDREIFVGEYEAKMCMYAVERIAKERCKLNPDEMISEPGDGKLKVLEQKSEQEIRFLVETTRQKNREIDEAIEALATEGSGWSHPQFEKGSGYESNLGKIEKLSLGKAKGLKMEINADMSKWSAQDVFYKYFWLIALDPILYPQEKERILYFMCNYMDKELILPDELLFNLLDQKVAYQNDIIATMTNQLNSNTVLIKRNWLQGNFNYTSSYVHSCAMSVYKEILKEAITLLDGSILVNSLVHSDDNQTSITIVQDKMENDKIIDFAMKEFERACLTFGCQANMKKTYVTNCIKEFVSLFNLYGEPFSIYGRFLLTSVGDCAYIGPYEDLASRISSAQTAIKHGCPPSLAWVSIAISHWMTSLTYNMLPGQSNDPIDYFPAENRKDIPIELNGVLDAPLSMISTVGLESGNLYFLIKLLSKYTPVMQKRESVVNQIAEVKNWKVEDLTDNEIFRLKILRYLVLDAEMDPSDIMGETSDMRGRSILTPRKFTTAGSLRKLYSFSKYQDRLSSPGGMVELFTYLLEKPELLVTKGEDMKDYMESVIFRYNSKRFKESLSIQNPAQLFIEQILFSHKPVIDFSGIRDKYINLHDSRALEKEPDILGKVTFTEAYRLLMRDLSSLELTNDDIQVIYSYIILNDPMMITIANTHILSIYGSPQRRMGMSCSTMPEFRNLKLIHHSPALVLRAYSKNNPDIQGADPTEMARDLVHLKEFVENTNLEEKMKVRIAMNEAEKGQRDIVFELKEMTRFYQVCYEYVKSTEHKIKVFILPAKSYTTTDFCSLMQGNLIKDKEWYTVHYLKQILSGGHKAIMQHNATSEQNIAFECFKLITHFADSFIDSLSRSAFLQLIIDEFSYKDVKVSKLYDIIKNGYNRTDFIPLLFRTGDLRQADLDKYDAMKSHERVTWNDWQTSRHLDMGSINLTITGYNRSITIIGEDNKLTYAELCLTRKTPENITISGRKLLGSRHGLKFENMSKIQTYPGNYYITYRKKDRHQFVYQIHSHESITRRNEEHMAIRTRIYNEITPVCVVNVAEVDGDQRILIRSLDYLNNDIFSLSRIKVGLDEFATIKKAHFSKMVSFEGPPIKTGLLDLTELMKSQDLLNLNYDNIRNSNLISFSKLICCEGSDNINDGLEFLSDDPMNFTEGEAIHSTPIFNIYYSKRGERHMTYRNAIKLLIERETKIFEEAFTFSENGFISPENLGCLEAVVSLIKLLKTNEWSTVIDKCIHICLIKNGMDHMYHSFDVPKCFMGNPITRDINWVMFREFINSLPGTDIPPWNVMTENFKKKCIALINSKFETQRDFSEFTKLMKKEGGRSNIEFD

Source Source

Source organism organism	La Crosse virus
NCBI taxonomy ID ncbi_taxonomy_id	11577
Host organism host_organism	Trichoplusia ni

Entity 3 Entity 3 polymer

Description description	;RNA (5'-R(PAPCPGPAPGPUPGPUPCPGPUPAPCPCPAPAP*G)-3') ;
Molecular weight formula_weight	5466.3 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polyribonucleotide
Chain IDs strand_id	H

ACGAGUGUCGUACCAAG

Entity 4 Entity 4 polymer

Description description	;RNA (5'-R(PCPUPUPGPGPUPAPGPUPAPCPAPCPUPAPCP*U)-3') ;
Molecular weight formula_weight	7882.7 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polyribonucleotide
Chain IDs strand_id	T

UAUCUAUACUUGGUAGUACACUACU

Entity 5 Entity 5 non-polymer

Description description	7-METHYL-GUANOSINE-5'-TRIPHOSPHATE-5'-GUANOSINE
Molecular weight formula_weight	803.4 kDa
Source method src_method	syn
Copy count entity_count	1

Entity 6 Entity 6 non-polymer

Description description	MAGNESIUM ION
Molecular weight formula_weight	24.3 kDa
Source method src_method	syn
Copy count entity_count	1

Entity 7 Entity 7 non-polymer

Description description	PYROPHOSPHATE 2-
Molecular weight formula_weight	176.0 kDa
Source method src_method	syn
Copy count entity_count	1

Entity 8 Entity 8 non-polymer

Description description	ZINC ION
Molecular weight formula_weight	65.4 kDa
Source method src_method	syn
Copy count entity_count	1

▼

6. Fold Classification (SCOP + CATH) 1 domains

CATH v4.4 (1 domains)

Domain ID domain_id	7orlA01
Class class	3 — Alpha Beta
Architecture architecture	40 — 3-Layer(aba) Sandwich
Topology topology	91 — Restriction Endonuclease
Homologous superfamily homologous superfamily	60 —

▶

Unit-cell length a length_a	1.000 Å
Unit-cell length b length_b	1.000 Å
Unit-cell length c length_c	1.000 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	90.00 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	—

Space group space_group	P 1
Space-group number int_tables_number	1
Crystal system crystal_system	—

Resolution resolution	3.60 Å
Resolution测定Method resolution_method	—
颗粒数 num_particles	19112

La Crosse virus polymerase at transcription initiation stage

1. Protein Identity and Related Structures Protein Identity & Related Structures

RNA-directed RNA polymerase L

State in the Current Structure

Other States of the Same Protein in the Database

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

7orl__assembly_1__model_1

7orl__assembly_1__model_1 | I(q)

7orl__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

冷冻电镜 EM 3D

5. Entities and Polymers Entities & Polymers (8)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Source Source

Entity 3 Entity 3 polymer

Polymer Polymer

Entity 4 Entity 4 polymer

Polymer Polymer

Entity 5 Entity 5 non-polymer

Entity 6 Entity 6 non-polymer

Entity 7 Entity 7 non-polymer

Entity 8 Entity 8 non-polymer

6. Fold Classification (SCOP + CATH) 1 domains

CATH v4.4 (1 domains)

7. Citations (1)

La Crosse virus polymerase at transcription initiation stage

1. Protein Identity and Related Structures Protein Identity & Related Structures

RNA-directed RNA polymerase L

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

7orl__assembly_1__model_1

7orl__assembly_1__model_1 | I(q)

7orl__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

冷冻电镜 EM 3D

5. Entities and Polymers Entities & Polymers (8)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Source Source

Entity 3 Entity 3 polymer

Polymer Polymer

Entity 4 Entity 4 polymer

Polymer Polymer

Entity 5 Entity 5 non-polymer

Entity 6 Entity 6 non-polymer

Entity 7 Entity 7 non-polymer

Entity 8 Entity 8 non-polymer

6. Fold Classification (SCOP + CATH) 1 domains

CATH v4.4 (1 domains)

7. Citations (1)