SAXSdb — 7xd8

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

NS5

Dengue virus 2

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–RNA	Monomer	Protein 1 RNA 2	RNA (30-mer) × 1 RNA (9-mer) × 1 ZINC ION × 2 GLYCEROL × 1 water × 3	Consistent with all polymers
2	Protein–RNA	Monomer	Protein 1 RNA 2	RNA (30-mer) × 1 RNA (9-mer) × 1 ZINC ION × 2 GLYCEROL × 2 water × 3	Consistent with all polymers
3	Protein–RNA	Monomer	Protein 1 RNA 2	RNA (30-mer) × 1 RNA (9-mer) × 1 ZINC ION × 2 water × 3	Consistent with all polymers
4	Protein–RNA	Monomer	Protein 1 RNA 2	RNA (30-mer) × 1 RNA (9-mer) × 1 ZINC ION × 2 water × 3	Consistent with all polymers
5	Protein–RNA	Monomer	Protein 1 RNA 2	RNA (30-mer) × 1 RNA (9-mer) × 1 ZINC ION × 2 GLYCEROL × 1 water × 2	Consistent with all polymers
6	Protein–RNA	Monomer	Protein 1 RNA 2	RNA (30-mer) × 1 RNA (9-mer) × 1 ZINC ION × 2 GLYCEROL × 1 water × 2	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	Q91H74_9FLAV
Isoform	—
PDB entities	1
Chains and sequence ranges	Author chain A； PDBConstruct 1–637； UniProt 2755–3391 Author chain D； PDBConstruct 1–637； UniProt 2755–3391 Author chain G； PDBConstruct 1–637； UniProt 2755–3391 Author chain J； PDBConstruct 1–637； UniProt 2755–3391 Author chain M； PDBConstruct 1–637； UniProt 2755–3391 Author chain P； PDBConstruct 1–637； UniProt 2755–3391

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	7xd8
Deposition date deposition_date	2022-03-26
Structure title title	Crystal Structure of Dengue Virus Serotype 2 (DENV2) Polymerase Elongation Complex (Native Form)
Keywords keywords	RNA-dependent RNA polymerase, de novo synthesis, elongation complex, priming element, TRANSFERASE, TRANSFERASE-RNA complex; TRANSFERASE/RNA
Experimental Method method	X-RAY DIFFRACTION

▼

3. Official assembly/model SAXS Official SAXS Profiles

This page reads only the latest assembly calculations. Every curve maps to an explicit PDB entry, official biological assembly and coordinate model.

7xd8__assembly_6__model_1

Assembly 6 · Model 1 · CRYSOL 4.1.3-1-20251215 (887e7ef)

Download this curve (.dat)

7xd8__assembly_6__model_1 | I(q)

100 plotted points; both axes use logarithmic scales.

7xd8__assembly_6__model_1 | P(r) · Pending

P(r) will be calculated and displayed separately for the same assembly/model.

Rg（Guinier）	25.74 Å
Rg (electron density)	25.21 Å
Total Rg	25.87 Å
Atom count	4592
Residues	631
Excluded volume	77551 Å³
Maximum q	0.500 Å⁻¹

Assembly	Model	Structure unit	Oligomeric description	Status	CRYSOL	Actions
1	1	`7xd8__assembly_1__model_1`	trimeric （3）	Success	4.1.3-1-20251215 (887e7ef)	View Download
2	1	`7xd8__assembly_2__model_1`	trimeric （3）	Success	4.1.3-1-20251215 (887e7ef)	View Download
3	1	`7xd8__assembly_3__model_1`	trimeric （3）	Success	4.1.3-1-20251215 (887e7ef)	View Download
4	1	`7xd8__assembly_4__model_1`	trimeric （3）	Success	4.1.3-1-20251215 (887e7ef)	View Download
5	1	`7xd8__assembly_5__model_1`	trimeric （3）	Success	4.1.3-1-20251215 (887e7ef)	View Download
6	1	`7xd8__assembly_6__model_1`	trimeric （3）	Success	4.1.3-1-20251215 (887e7ef)	View Download

▶

4. Crystallography and Experiment 4. Crystallography & Experiment

▶

5. Entities and Polymers Entities & Polymers (6)

Entity 1 Entity 1 polymer

Description description	NS5
Molecular weight formula_weight	75110.3 kDa
Source method src_method	man
Copy count entity_count	6

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A,D,G,J,M,P
Atom count atom_count	31489

NIGIESETPNLDIIGKRIEKIKQEHETSWHYDQDHPYKTWAYHGSYETKQTGSASSMVNGVVRLLTKPWDIIPMVTQMAMTDTTPFGQQRVFKEKVDTRTQEPKEGTKKLMKITAEWLWKELGKKKTPRMCTREEFTRKVRSNAALGAIFTDENKWKSAREAVEDSGFWELVDKERNLHLEGKCETCVYNMMGKREKKLGEFGKAKGSRAIWYMWLGARFLEFEALGFLNEDHWFSRENSLSGVEGEGLHKLGYILRDVSKKEGGAMYADDTAGWDTRITLEDLKNEEMVTNHMEGEHKKLAEAIFKLTYQNKVVRVQRPTPRGTVMDIISRRDQRGSGQVVTYGLNTFTNMEAQLIRQMEGEGVFKSIQHLTVTEEIAVKNWLVRVGRERLSRMAISGDDCVVKPLDDRFASALTALNDMGKVRKDIQQWEPSRGWNDWTQVPFCSHHFHELIMKDGRVLVVPCRNQDELIGRARISQGAGWSLRETACLGKSYAQMWSLMYFHRRDLRLAANAICSAVPSHWVPTSRTTWSIHATHEWMTTEDMLTVWNRVWIQENPWMEDKTPVESWEEIPYLGKREDQWCGSLIGLTSRATWAKNIQTAINQVRSLIGNEEYTDYMPSMKRFRREEEEAGVLWGSSSHHHHHH

Source Source

Source organism organism	Dengue virus 2
NCBI taxonomy ID ncbi_taxonomy_id	11060
Host organism host_organism	Escherichia coli

Entity 2 Entity 2 polymer

Description description	RNA (30-mer)
Molecular weight formula_weight	9621.8 kDa
Source method src_method	syn
Copy count entity_count	6

Polymer Polymer

Polymer type type	polyribonucleotide
Chain IDs strand_id	B,E,H,K,N,Q

GGGAGAUGAAAAUCUCCAACGAUUAUAUCC

Entity 3 Entity 3 polymer

Description description	RNA (9-mer)
Molecular weight formula_weight	2880.8 kDa
Source method src_method	syn
Copy count entity_count	6

Polymer Polymer

Polymer type type	polyribonucleotide
Chain IDs strand_id	C,F,I,L,O,R

GGAUAUAAU

Entity 4 Entity 4 non-polymer

Description description	ZINC ION
Molecular weight formula_weight	65.4 kDa
Source method src_method	syn
Copy count entity_count	12

Entity 5 Entity 5 non-polymer

Description description	GLYCEROL
Molecular weight formula_weight	92.1 kDa
Source method src_method	syn
Copy count entity_count	5

Entity 6 Entity 6 water

Description description	water
Molecular weight formula_weight	18.0 kDa
Source method src_method	nat
Copy count entity_count	177

▶

Unit-cell length a length_a	141.728 Å
Unit-cell length b length_b	156.319 Å
Unit-cell length c length_c	174.424 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	94.22 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	12

Space group space_group	P 1 21 1
Space-group number int_tables_number	4
Crystal system crystal_system	—

Resolution resolution	2.850 Å
Low-resolution limit resolution_low	49.920 Å
R factor r_factor	0.2009
R_work r_work	0.1986
R_free r_free	0.2430

Crystal Structure of Dengue Virus Serotype 2 (DENV2) Polymerase Elongation Complex (Native Form)

1. Protein Identity and Related Structures Protein Identity & Related Structures

NS5

State in the Current Structure

Other States of the Same Protein in the Database

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

7xd8__assembly_6__model_1

7xd8__assembly_6__model_1 | I(q)

7xd8__assembly_6__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (6)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 polymer

Polymer Polymer

Entity 4 Entity 4 non-polymer

Entity 5 Entity 5 non-polymer

Entity 6 Entity 6 water

7. Citations (1)

Crystal Structure of Dengue Virus Serotype 2 (DENV2) Polymerase Elongation Complex (Native Form)

1. Protein Identity and Related Structures Protein Identity & Related Structures

NS5

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

7xd8__assembly_6__model_1

7xd8__assembly_6__model_1 | I(q)

7xd8__assembly_6__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (6)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 polymer

Polymer Polymer

Entity 4 Entity 4 non-polymer

Entity 5 Entity 5 non-polymer

Entity 6 Entity 6 water

7. Citations (1)