SAXSdb — 8b0i

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

RNase adapter protein RapZ

Escherichia coli K-12

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–RNA	Homooligomer	Protein 4 RNA 1	GlmZ small regulatory RNA × 1	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	RAPZ_ECOLI
Isoform	—
PDB entities	1
Chains and sequence ranges	Author chain A； PDBConstruct 1–284； UniProt 1–284 Author chain B； PDBConstruct 1–284； UniProt 1–284 Author chain C； PDBConstruct 1–284； UniProt 1–284 Author chain D； PDBConstruct 1–284； UniProt 1–284

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	8b0i
Deposition date deposition_date	2022-09-07
Structure title title	CryoEM structure of bacterial RapZ.GlmZ complex central to the control of cell envelope biogenesis
Keywords keywords	endonuclease RNase E, adaptor protein RapZ, small regulatory RNA GlmZ, RNA BINDING PROTEIN; RNA BINDING PROTEIN
Experimental Method method	ELECTRON MICROSCOPY

▼

3. Official assembly/model SAXS Official SAXS Profiles

This page reads only the latest assembly calculations. Every curve maps to an explicit PDB entry, official biological assembly and coordinate model.

8b0i__assembly_1__model_1

Assembly 1 · Model 1 · CRYSOL 4.1.3-1-20251215 (887e7ef)

Download this curve (.dat)

8b0i__assembly_1__model_1 | I(q)

100 plotted points; both axes use logarithmic scales.

8b0i__assembly_1__model_1 | P(r) · Pending

P(r) will be calculated and displayed separately for the same assembly/model.

Rg（Guinier）	38.88 Å
Rg (electron density)	37.51 Å
Total Rg	38.11 Å
Atom count	17636
Residues	1178
Excluded volume	164650 Å³
Maximum q	0.500 Å⁻¹

Assembly	Model	Structure unit	Oligomeric description	Status	CRYSOL	Actions
1	1	`8b0i__assembly_1__model_1`	pentameric （5）	Success	4.1.3-1-20251215 (887e7ef)	View Download

▶

4. Crystallography and Experiment 4. Crystallography & Experiment

▶

5. Entities and Polymers Entities & Polymers (2)

Entity 1 Entity 1 polymer

Description description	RNase adapter protein RapZ
Molecular weight formula_weight	32538.3 kDa
Source method src_method	man
Copy count entity_count	4

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A,B,D,C
Atom count atom_count	17636

MVLMIVSGRSGSGKSVALRALEDMGFYCVDNLPVVLLPDLARTLADREISAAVSIDVRNMPESPEIFEQAMSNLPDAFSPQLLFLDADRNTLIRRYSDTRRLHPLSSKNLSLESAIDKESDLLEPLRSRADLIVDTSEMSVHELAEMLRTRLLGKRERELTMVFESFGFKHGIPIDADYVFDVRFLPNPHWDPKLRPMTGLDKPVAAFLDRHTEVHNFIYQTRSYLELWLPMLETNNRSYLTVAIGCTGGKHRSVYIAEQLADYFRSRGKNVQSRHRTLEKRKP

Source Source

Source organism organism	Escherichia coli K-12
NCBI taxonomy ID ncbi_taxonomy_id	83333
Host organism host_organism	Escherichia coli

Entity 2 Entity 2 polymer

Description description	GlmZ small regulatory RNA
Molecular weight formula_weight	66061.9 kDa
Source method src_method	man
Copy count entity_count	1

Polymer Polymer

Polymer type type	polyribonucleotide
Chain IDs strand_id	K

GUAGAUGCUCAUUCCAUCUCUUAUGUUCGCCUUAGUGCCUCAUAAACUCCGGAAUGACGCAGAGCCGUUUACGGUGCUUAUCGUCCACUGACAGAUGUCGCUUAUGCCUCAUCAGACACCAUGGACACAACGUUGAGUGAAGCACCCACUUGUUGUCAUACAGACCUGUUUUAACGCCUGCUCCGUUAAUAAGAGCAGGCGUUUUUU

Source Source

Source organism organism	Escherichia coli K-12
NCBI taxonomy ID ncbi_taxonomy_id	83333
Host organism host_organism	Escherichia coli

▶

Unit-cell length a length_a	1.000 Å
Unit-cell length b length_b	1.000 Å
Unit-cell length c length_c	1.000 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	90.00 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	—

Space group space_group	P 1
Space-group number int_tables_number	1
Crystal system crystal_system	—

Resolution resolution	4.28 Å
Resolution测定Method resolution_method	—
颗粒数 num_particles	27551

CryoEM structure of bacterial RapZ.GlmZ complex central to the control of cell envelope biogenesis

1. Protein Identity and Related Structures Protein Identity & Related Structures

RNase adapter protein RapZ

State in the Current Structure

Other States of the Same Protein in the Database

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

8b0i__assembly_1__model_1

8b0i__assembly_1__model_1 | I(q)

8b0i__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

冷冻电镜 EM 3D

5. Entities and Polymers Entities & Polymers (2)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Source Source

7. Citations (2)

CryoEM structure of bacterial RapZ.GlmZ complex central to the control of cell envelope biogenesis

1. Protein Identity and Related Structures Protein Identity & Related Structures

RNase adapter protein RapZ

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

8b0i__assembly_1__model_1

8b0i__assembly_1__model_1 | I(q)

8b0i__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

冷冻电镜 EM 3D

5. Entities and Polymers Entities & Polymers (2)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Source Source

7. Citations (2)