SAXSdb — 8efy

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

Holliday junction ATP-dependent DNA helicase RuvB

Thermus thermophilus HB8

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–DNA	Homooligomer	Protein 12 DNA 4	ssDNA × 2 ssDNA × 2 ADENOSINE-5'-DIPHOSPHATE × 6 MAGNESIUM ION × 8 PHOSPHOTHIOPHOSPHORIC ACID-ADENYLATE ESTER × 6	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	RUVB_THET8
Isoform	—
PDB entities	1
Chains and sequence ranges	Author chain A； PDBConstruct 1–324； UniProt 1–324 Author chain B； PDBConstruct 1–324； UniProt 1–324 Author chain C； PDBConstruct 1–324； UniProt 1–324 Author chain D； PDBConstruct 1–324； UniProt 1–324 Author chain E； PDBConstruct 1–324； UniProt 1–324 Author chain F； PDBConstruct 1–324； UniProt 1–324 Author chain I； PDBConstruct 1–324； UniProt 1–324 Author chain J； PDBConstruct 1–324； UniProt 1–324 Author chain K； PDBConstruct 1–324； UniProt 1–324 Author chain L； PDBConstruct 1–324； UniProt 1–324 Author chain M； PDBConstruct 1–324； UniProt 1–324 Author chain N； PDBConstruct 1–324； UniProt 1–324

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	8efy
Deposition date deposition_date	2022-09-10
Structure title title	Structure of double homo-hexameric AAA+ ATPase RuvB motors
Keywords keywords	Holliday Junction, AAA+ ATPase, RuvB, Homo-hexamer, DNA recombination, STRUCTURAL PROTEIN; STRUCTURAL PROTEIN
Experimental Method method	ELECTRON MICROSCOPY

▼

3. Official assembly/model SAXS Official SAXS Profiles

This page reads only the latest assembly calculations. Every curve maps to an explicit PDB entry, official biological assembly and coordinate model.

8efy__assembly_1__model_1

Assembly 1 · Model 1 · CRYSOL 4.1.3-1-20251215 (887e7ef)

Download this curve (.dat)

8efy__assembly_1__model_1 | I(q)

100 plotted points; both axes use logarithmic scales.

8efy__assembly_1__model_1 | P(r) · Pending

P(r) will be calculated and displayed separately for the same assembly/model.

Rg（Guinier）	50.40 Å
Rg (electron density)	50.02 Å
Total Rg	50.22 Å
Atom count	31274
Residues	3801
Excluded volume	552870 Å³
Maximum q	0.500 Å⁻¹

Assembly	Model	Structure unit	Oligomeric description	Status	CRYSOL	Actions
1	1	`8efy__assembly_1__model_1`	hexadecameric （16）	Success	4.1.3-1-20251215 (887e7ef)	View Download

▶

4. Crystallography and Experiment 4. Crystallography & Experiment

▶

5. Entities and Polymers Entities & Polymers (6)

Entity 1 Entity 1 polymer

Description description	Holliday junction ATP-dependent DNA helicase RuvB
Molecular weight formula_weight	36024.7 kDa
EC 编号 ec_number	3.6.4.12
Source method src_method	man
Copy count entity_count	12

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A,B,C,D,E,F,I,J,K,L,M,N
Atom count atom_count	31274

MEDLALRPKTLDEYIGQERLKQKLRVYLEAAKARKEPLEHLLLFGPPGLGKTTLAHVIAHELGVNLRVTSGPAIEKPGDLAAILANSLEEGDILFIDEIHRLSRQAEEHLYPAMEDFVMDIVIGQGPAARTIRLELPRFTLIGATTRPGLITAPLLSRFGIVEHLEYYTPEELAQGVMRDARLLGVRITEEAALEIGRRSRGTMRVAKRLFRRVRDFAQVAGEEVITRERALEALAALGLDELGLEKRDREILEVLILRFGGGPVGLATLATALSEDPGTLEEVHEPYLIRQGLLKRTPRGRVATELAYRHLGYPPPVGPLLEP

Source Source

Source organism organism	Thermus thermophilus HB8
NCBI taxonomy ID ncbi_taxonomy_id	300852
Host organism host_organism	Escherichia coli

Entity 2 Entity 2 polymer

Description description	ssDNA
Molecular weight formula_weight	15146.7 kDa
Source method src_method	syn
Copy count entity_count	2

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	G,O

AGAATCTGCCGAGAGACCGAGCAGAATTCTATGTGTTTACCAAGCGCTG

Entity 3 Entity 3 polymer

Description description	ssDNA
Molecular weight formula_weight	15691.1 kDa
Source method src_method	syn
Copy count entity_count	2

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	H,P

CAGCGCTTGGTAAACACATAGAATTCTGCTCTCGGTCTGAGCCGTCTAAGA

Entity 4 Entity 4 non-polymer

Description description	ADENOSINE-5'-DIPHOSPHATE
Molecular weight formula_weight	427.2 kDa
Source method src_method	syn
Copy count entity_count	6

Entity 5 Entity 5 non-polymer

Description description	MAGNESIUM ION
Molecular weight formula_weight	24.3 kDa
Source method src_method	syn
Copy count entity_count	8

Entity 6 Entity 6 non-polymer

Description description	PHOSPHOTHIOPHOSPHORIC ACID-ADENYLATE ESTER
Molecular weight formula_weight	523.2 kDa
Source method src_method	syn
Copy count entity_count	6

▶

Unit-cell length a length_a	1.000 Å
Unit-cell length b length_b	1.000 Å
Unit-cell length c length_c	1.000 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	90.00 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	—

Space group space_group	P 1
Space-group number int_tables_number	1
Crystal system crystal_system	—

Resolution resolution	3.16 Å
Resolution测定Method resolution_method	—
颗粒数 num_particles	326270

Structure of double homo-hexameric AAA+ ATPase RuvB motors

1. Protein Identity and Related Structures Protein Identity & Related Structures

Holliday junction ATP-dependent DNA helicase RuvB

State in the Current Structure

Other States of the Same Protein in the Database

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

8efy__assembly_1__model_1

8efy__assembly_1__model_1 | I(q)

8efy__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

冷冻电镜 EM 3D

5. Entities and Polymers Entities & Polymers (6)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 polymer

Polymer Polymer

Entity 4 Entity 4 non-polymer

Entity 5 Entity 5 non-polymer

Entity 6 Entity 6 non-polymer

7. Citations (1)

Structure of double homo-hexameric AAA+ ATPase RuvB motors

1. Protein Identity and Related Structures Protein Identity & Related Structures

Holliday junction ATP-dependent DNA helicase RuvB

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

8efy__assembly_1__model_1

8efy__assembly_1__model_1 | I(q)

8efy__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

冷冻电镜 EM 3D

5. Entities and Polymers Entities & Polymers (6)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 polymer

Polymer Polymer

Entity 4 Entity 4 non-polymer

Entity 5 Entity 5 non-polymer

Entity 6 Entity 6 non-polymer

7. Citations (1)