SAXSdb — 8ojb

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

DNA polymerase catalytic subunit

Human alphaherpesvirus 1 strain KOS

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–DNA	Monomer	Protein 1 DNA 1	DNA (47-MER) × 1 CALCIUM ION × 2 water × 1	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	DPOL_HHV11
Isoform	—
PDB entities	2
Chains and sequence ranges	Author chain A； PDBConstruct 1–1235； UniProt 1–1235

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	8ojb
Deposition date deposition_date	2023-03-24
Structure title title	HSV-1 DNA polymerase-processivity factor complex in exonuclease state active site
Keywords keywords	DNA, Polymerase, Complex, TRANSFERASE; TRANSFERASE
Experimental Method method	ELECTRON MICROSCOPY

▼

3. Official assembly/model SAXS Official SAXS Profiles

This page reads only the latest assembly calculations. Every curve maps to an explicit PDB entry, official biological assembly and coordinate model.

8ojb__assembly_1__model_1

Assembly 1 · Model 1 · CRYSOL 4.1.3-1-20251215 (887e7ef)

Download this curve (.dat)

8ojb__assembly_1__model_1 | I(q)

100 plotted points; both axes use logarithmic scales.

8ojb__assembly_1__model_1 | P(r) · Pending

P(r) will be calculated and displayed separately for the same assembly/model.

Rg（Guinier）	32.34 Å
Rg (electron density)	31.41 Å
Total Rg	31.97 Å
Atom count	6653
Residues	837
Excluded volume	118890 Å³
Maximum q	0.500 Å⁻¹

Assembly	Model	Structure unit	Oligomeric description	Status	CRYSOL	Actions
1	1	`8ojb__assembly_1__model_1`	dimeric （2）	Success	4.1.3-1-20251215 (887e7ef)	View Download

▶

4. Crystallography and Experiment 4. Crystallography & Experiment

▶

5. Entities and Polymers Entities & Polymers (4)

Entity 1 Entity 1 polymer

Description description	DNA (47-MER)
Molecular weight formula_weight	14260.2 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	C
Atom count atom_count	6785

GCCACTACGACACCTTGATCGCCTCGCAGCCGTCCAACCAACTCAAA

Entity 2 Entity 2 polymer

Description description	DNA polymerase catalytic subunit
Molecular weight formula_weight	136683.8 kDa
EC 编号 ec_number	2.7.7.7,3.1.26.4
Source method src_method	man
Copy count entity_count	1

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A

MFSGGGGPLSPGGKSAARAASGFFAPAGPRGASRGPPPCLRQNFYNPYLAPVGTQQKPTGPTQRHTYYSECDEFRFIAPRVLDEDAPPEKRAGVHDGHLKRAPKVYCGGDERDVLRVGSGGFWPRRSRLWGGVDHAPAGFNPTVTVFHVYDILENVEHAYGMRAAQFHARFMDAITPTGTVITLLGLTPEGHRVAVHVYGTRQYFYMNKEEVDRHLQCRAPRDLCERMAAALRESPGASFRGISADHFEAEVVERTDVYYYETRPALFYRVYVRSGRVLSYLCDNFCPAIKKYEGGVDATTRFILDNPGFVTFGWYRLKPGRNNTLAQPRAPMAFGTSSDVEFNCTADNLAIEGGMSDLPAYKLMCFDIECKAGGEDELAFPVAGHPEDLVIQISCLLYDLSTTALEHVLLFSLGSCDLPESHLNELAARGLPTPVVLEFDSEFEMLLAFMTLVKQYGPEFVTGYNIINFDWPFLLAKLTDIYKVPLDGYGRMNGRGVFRVWDIGQSHFQKRSKIKVNGMVNIDMYGIITDKIKLSSYKLNAVAEAVLKDKKKDLSYRDIPAYYAAGPAQRGVIGEYCIQDSLLVGQLFFKFLPHLELSAVARLAGINITRTIYDGQQIRVFTCLLRLADQKGFILPDTQGRFRGAGGEAPKRPAAAREDEERPEEEGEDEDEREEGGGEREPEGARETAGRHVGYQGARVLDPTSGFHVNPVVVFDFASLYPSIIQAHNLCFSTLSLRADAVAHLEAGKDYLEIEVGGRRLFFVKAHVRESLLSILLRDWLAMRKQIRSRIPQSSPEEAVLLDKQQAAIKVVCNSVYGFTGVQHGLLPCLHVAATVTTIGREMLLATREYVHARWAAFEQLLADFPEAADMRAPGPYSMRIIYGDTDSIFVLCRGLTAAGLTAVGDKMASHISRALFLPPIKLECEKTFTKLLLIAKKKYIGVIYGGKMLIKGVDLVRKNNCAFINRTSRALVDLLFYDDTVSGAAAALAERPAEEWLARPLPEGLQAFGAVLVDAHRRITDPERDIQDFVLTAELSRHPRAYTNKRLAHLTVYYKLMARRAQVPSIKDRIPYVIVAQTREVEETVARLAALRELDAAAPGDEPAPPAALPSPAKRPRETPSPADPPGGASKPRKLLVSELAEDPAYAIAHGVALNTDYYFSHLLGAACVTFKALFGNNAKITESLLKRFIPEVWHPPDDVAARLRTAGFGAVGAGATAEETRRMLHRAFDTLA

Source Source

Source organism organism	Human alphaherpesvirus 1 strain KOS
NCBI taxonomy ID ncbi_taxonomy_id	10306
Host organism host_organism	Spodoptera frugiperda

Entity 3 Entity 3 non-polymer

Description description	CALCIUM ION
Molecular weight formula_weight	40.1 kDa
Source method src_method	syn
Copy count entity_count	2

Entity 4 Entity 4 water

Description description	water
Molecular weight formula_weight	18.0 kDa
Source method src_method	nat
Copy count entity_count	116

▶

Unit-cell length a length_a	1.000 Å
Unit-cell length b length_b	1.000 Å
Unit-cell length c length_c	1.000 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	90.00 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	—

Space group space_group	P 1
Space-group number int_tables_number	1
Crystal system crystal_system	—

Resolution resolution	1.900 Å
Low-resolution limit resolution_low	1.900 Å
R factor r_factor	—
R_work r_work	0.3852
R_free r_free	—

Resolution resolution	1.90 Å
Resolution测定Method resolution_method	—
颗粒数 num_particles	142948

HSV-1 DNA polymerase-processivity factor complex in exonuclease state active site

1. Protein Identity and Related Structures Protein Identity & Related Structures

DNA polymerase catalytic subunit

State in the Current Structure

Other States of the Same Protein in the Database

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

8ojb__assembly_1__model_1

8ojb__assembly_1__model_1 | I(q)

8ojb__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

冷冻电镜 EM 3D

5. Entities and Polymers Entities & Polymers (4)

Entity 1 Entity 1 polymer

Polymer Polymer

Entity 2 Entity 2 polymer

Polymer Polymer

Source Source

Entity 3 Entity 3 non-polymer

Entity 4 Entity 4 water

7. Citations (1)

HSV-1 DNA polymerase-processivity factor complex in exonuclease state active site

1. Protein Identity and Related Structures Protein Identity & Related Structures

DNA polymerase catalytic subunit

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

8ojb__assembly_1__model_1

8ojb__assembly_1__model_1 | I(q)

8ojb__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

冷冻电镜 EM 3D

5. Entities and Polymers Entities & Polymers (4)

Entity 1 Entity 1 polymer

Polymer Polymer

Entity 2 Entity 2 polymer

Polymer Polymer

Source Source

Entity 3 Entity 3 non-polymer

Entity 4 Entity 4 water

7. Citations (1)