SAXSdb — 9enp

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

DNA polymerase catalytic subunit

Human alphaherpesvirus 1 strain KOS

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–DNA	Heteromer	Protein 2 DNA 2	DNA polymerase processivity factor × 1 （P10226） DNA (46-MER) × 1 DNA (67-MER) × 1 CALCIUM ION × 2 water × 2	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	DPOL_HHV11
Isoform	—
PDB entities	1
Chains and sequence ranges	Author chain A； PDBConstruct 1–1235； UniProt 1–1235

DNA polymerase processivity factor

Human alphaherpesvirus 1 strain KOS

UniProt P10226

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–DNA	Heteromer	Protein 2 DNA 2	DNA polymerase catalytic subunit × 1 （P04293） DNA (46-MER) × 1 DNA (67-MER) × 1 CALCIUM ION × 2 water × 2	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	PAP_HHV11
Isoform	—
PDB entities	2
Chains and sequence ranges	Author chain B； PDBConstruct 1–488； UniProt 1–488

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	9enp
Deposition date deposition_date	2024-03-13
Structure title title	HSV-1 DNA polymerase-processivity factor complex in exonuclease state with 1-bp DNA mismatch
Keywords keywords	DNA, Polymerase, Complex, TRANSFERASE; TRANSFERASE
Experimental Method method	ELECTRON MICROSCOPY

▼

3. Official assembly/model SAXS Official SAXS Profiles

This page reads only the latest assembly calculations. Every curve maps to an explicit PDB entry, official biological assembly and coordinate model.

9enp__assembly_1__model_1

Assembly 1 · Model 1 · CRYSOL 4.1.3-1-20251215 (887e7ef)

Download this curve (.dat)

9enp__assembly_1__model_1 | I(q)

100 plotted points; both axes use logarithmic scales.

9enp__assembly_1__model_1 | P(r) · Pending

P(r) will be calculated and displayed separately for the same assembly/model.

Rg（Guinier）	44.62 Å
Rg (electron density)	44.35 Å
Total Rg	44.43 Å
Atom count	11523
Residues	1386
Excluded volume	202720 Å³
Maximum q	0.500 Å⁻¹

Assembly	Model	Structure unit	Oligomeric description	Status	CRYSOL	Actions
1	1	`9enp__assembly_1__model_1`	tetrameric （4）	Success	4.1.3-1-20251215 (887e7ef)	View Download

▶

4. Crystallography and Experiment 4. Crystallography & Experiment

▶

5. Entities and Polymers Entities & Polymers (6)

Entity 1 Entity 1 polymer

Description description	DNA polymerase catalytic subunit
Molecular weight formula_weight	136683.8 kDa
EC 编号 ec_number	2.7.7.7,3.1.26.4
Source method src_method	man
Copy count entity_count	1

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A
Atom count atom_count	11552

MFSGGGGPLSPGGKSAARAASGFFAPAGPRGASRGPPPCLRQNFYNPYLAPVGTQQKPTGPTQRHTYYSECDEFRFIAPRVLDEDAPPEKRAGVHDGHLKRAPKVYCGGDERDVLRVGSGGFWPRRSRLWGGVDHAPAGFNPTVTVFHVYDILENVEHAYGMRAAQFHARFMDAITPTGTVITLLGLTPEGHRVAVHVYGTRQYFYMNKEEVDRHLQCRAPRDLCERMAAALRESPGASFRGISADHFEAEVVERTDVYYYETRPALFYRVYVRSGRVLSYLCDNFCPAIKKYEGGVDATTRFILDNPGFVTFGWYRLKPGRNNTLAQPRAPMAFGTSSDVEFNCTADNLAIEGGMSDLPAYKLMCFDIECKAGGEDELAFPVAGHPEDLVIQISCLLYDLSTTALEHVLLFSLGSCDLPESHLNELAARGLPTPVVLEFDSEFEMLLAFMTLVKQYGPEFVTGYNIINFDWPFLLAKLTDIYKVPLDGYGRMNGRGVFRVWDIGQSHFQKRSKIKVNGMVNIDMYGIITDKIKLSSYKLNAVAEAVLKDKKKDLSYRDIPAYYAAGPAQRGVIGEYCIQDSLLVGQLFFKFLPHLELSAVARLAGINITRTIYDGQQIRVFTCLLRLADQKGFILPDTQGRFRGAGGEAPKRPAAAREDEERPEEEGEDEDEREEGGGEREPEGARETAGRHVGYQGARVLDPTSGFHVNPVVVFDFASLYPSIIQAHNLCFSTLSLRADAVAHLEAGKDYLEIEVGGRRLFFVKAHVRESLLSILLRDWLAMRKQIRSRIPQSSPEEAVLLDKQQAAIKVVCNSVYGFTGVQHGLLPCLHVAATVTTIGREMLLATREYVHARWAAFEQLLADFPEAADMRAPGPYSMRIIYGDTDSIFVLCRGLTAAGLTAVGDKMASHISRALFLPPIKLECEKTFTKLLLIAKKKYIGVIYGGKMLIKGVDLVRKNNCAFINRTSRALVDLLFYDDTVSGAAAALAERPAEEWLARPLPEGLQAFGAVLVDAHRRITDPERDIQDFVLTAELSRHPRAYTNKRLAHLTVYYKLMARRAQVPSIKDRIPYVIVAQTREVEETVARLAALRELDAAAPGDEPAPPAALPSPAKRPRETPSPADPPGGASKPRKLLVSELAEDPAYAIAHGVALNTDYYFSHLLGAACVTFKALFGNNAKITESLLKRFIPEVWHPPDDVAARLRTAGFGAVGAGATAEETRRMLHRAFDTLA

Source Source

Source organism organism	Human alphaherpesvirus 1 strain KOS
NCBI taxonomy ID ncbi_taxonomy_id	10306
Host organism host_organism	Spodoptera frugiperda

Entity 2 Entity 2 polymer

Description description	DNA polymerase processivity factor
Molecular weight formula_weight	51208.0 kDa
Source method src_method	man
Copy count entity_count	1

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	B

MTDSPGGVAPASPVEDASDASLGQPEEGAPCQVVLQGAELNGILQAFAPLRTSLLDSLLVMGDRGILIHNTIFGEQVFLPLEHSQFSRYRWRGPTAAFLSLVDQKRSLLSVFRANQYPDLRRVELAITGQAPFRTLVQRIWTTTSDGEAVELASETLMKRELTSFVVLVPQGTPDVQLRLTRPQLTKVLNATGADSATPTTFELGVNGKFSVFTTSTCVTFAAREEGVSSSTSTQVQILSNALTKAGQAAANAKTVYGENTHRTFSVVVDDCSMRAVLRRLQVGGGTLKFFLTTPVPSLCVTATGPNAVSAVFLLKPQKICLDWLGHSQGSPSAGSSASRASGSEPTDSQDSASDAVSHGDPEDLDGAARAGEAGALHACPMPSSTTRVTPTTKRGRSGGEDARADTALKKPKTGSPTAPPPADPVPLDTEDDSDAADGTAARPAAPDARSGSRYACYFRDLPTGEASPGAFSAFRGGPQTPYGFGFP

Source Source

Source organism organism	Human alphaherpesvirus 1 strain KOS
NCBI taxonomy ID ncbi_taxonomy_id	10306
Host organism host_organism	Spodoptera frugiperda

Entity 3 Entity 3 polymer

Description description	DNA (46-MER)
Molecular weight formula_weight	13963.1 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	C

GCCACTACGACACCTTGATCGCCTCGCAGCCGTCCAACCAACTCAA

Entity 4 Entity 4 polymer

Description description	DNA (67-MER)
Molecular weight formula_weight	20902.3 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	D

ATTTGCTGACCTTTGTTCTGGGTGAGTTGGTTGGACGGCTGCGAGGCGATCAAGGTGTCGTAGTGGC

Entity 5 Entity 5 non-polymer

Description description	CALCIUM ION
Molecular weight formula_weight	40.1 kDa
Source method src_method	syn
Copy count entity_count	2

Entity 6 Entity 6 water

Description description	water
Molecular weight formula_weight	18.0 kDa
Source method src_method	nat
Copy count entity_count	7

▶

Unit-cell length a length_a	1.000 Å
Unit-cell length b length_b	1.000 Å
Unit-cell length c length_c	1.000 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	90.00 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	—

Space group space_group	P 1
Space-group number int_tables_number	1
Crystal system crystal_system	—

Resolution resolution	2.120 Å
Low-resolution limit resolution_low	2.120 Å
R factor r_factor	—
R_work r_work	0.3288
R_free r_free	—

Resolution resolution	2.12 Å
Resolution测定Method resolution_method	—
颗粒数 num_particles	577658

HSV-1 DNA polymerase-processivity factor complex in exonuclease state with 1-bp DNA mismatch

1. Protein Identity and Related Structures Protein Identity & Related Structures

DNA polymerase catalytic subunit

State in the Current Structure

Other States of the Same Protein in the Database

DNA polymerase processivity factor

State in the Current Structure

Other States of the Same Protein in the Database

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

9enp__assembly_1__model_1

9enp__assembly_1__model_1 | I(q)

9enp__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

冷冻电镜 EM 3D

5. Entities and Polymers Entities & Polymers (6)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Source Source

Entity 3 Entity 3 polymer

Polymer Polymer

Entity 4 Entity 4 polymer

Polymer Polymer

Entity 5 Entity 5 non-polymer

Entity 6 Entity 6 water

7. Citations (1)

HSV-1 DNA polymerase-processivity factor complex in exonuclease state with 1-bp DNA mismatch

1. Protein Identity and Related Structures Protein Identity & Related Structures

DNA polymerase catalytic subunit

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

DNA polymerase processivity factor

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

9enp__assembly_1__model_1

9enp__assembly_1__model_1 | I(q)

9enp__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

冷冻电镜 EM 3D

5. Entities and Polymers Entities & Polymers (6)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Source Source

Entity 3 Entity 3 polymer

Polymer Polymer

Entity 4 Entity 4 polymer

Polymer Polymer

Entity 5 Entity 5 non-polymer

Entity 6 Entity 6 water

7. Citations (1)