SAXSdb — 8qfs

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

Elongation factor Tu

OrganismNot specified

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–RNA	Heteromer	Protein 2 RNA 1	tRNA × 1 Protein SidH × 1 （Q6RCQ4） MAGNESIUM ION × 1 GUANOSINE-5'-TRIPHOSPHATE × 1	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	E2QJ06_ECOLX
Isoform	—
PDB entities	1
Chains and sequence ranges	Author chain C； PDBConstruct 1–394； UniProt 1–394

Protein SidH

;Escherichia coli 'BL21-Gold(DE3)pLysS AG' ;

UniProt Q6RCQ4

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–RNA	Heteromer	Protein 2 RNA 1	Elongation factor Tu × 1 （E2QJ06） tRNA × 1 MAGNESIUM ION × 1 GUANOSINE-5'-TRIPHOSPHATE × 1	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	Q6RCQ4_LEGPN
Isoform	—
PDB entities	3
Chains and sequence ranges	Author chain A； PDBConstruct 24–2248； UniProt 1–2225

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	8qfs
Deposition date deposition_date	2023-09-04
Structure title title	Cryo-EM structure of SidH from Legionella pneumophila
Keywords keywords	SidH, Legionella, tRNA-binding, EF-Tu-binding, RNA BINDING PROTEIN; RNA BINDING PROTEIN
Experimental Method method	ELECTRON MICROSCOPY

▼

3. Official assembly/model SAXS Official SAXS Profiles

This page reads only the latest assembly calculations. Every curve maps to an explicit PDB entry, official biological assembly and coordinate model.

8qfs__assembly_1__model_1

Assembly 1 · Model 1 · CRYSOL 4.1.3-1-20251215 (887e7ef)

Download this curve (.dat)

8qfs__assembly_1__model_1 | I(q)

100 plotted points; both axes use logarithmic scales.

8qfs__assembly_1__model_1 | P(r) · Pending

P(r) will be calculated and displayed separately for the same assembly/model.

Rg（Guinier）	42.49 Å
Rg (electron density)	42.52 Å
Total Rg	42.60 Å
Atom count	13294
Residues	1631
Excluded volume	232210 Å³
Maximum q	0.500 Å⁻¹

Assembly	Model	Structure unit	Oligomeric description	Status	CRYSOL	Actions
1	1	`8qfs__assembly_1__model_1`	trimeric （3）	Success	4.1.3-1-20251215 (887e7ef)	View Download

▶

4. Crystallography and Experiment 4. Crystallography & Experiment

▶

5. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Description description	Elongation factor Tu
Molecular weight formula_weight	43370.5 kDa
Source method src_method	nat
Copy count entity_count	1

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	C
Atom count atom_count	13294

MSKEKFERTKPHVNVGTIGHVDHGKTTLTAAITTVLAKTYGGAARAFDQIDNAPEEKARGITINTSHVEYDTPTRHYAHVDCPGHADYVKNMITGAAQMDGAILVVAATDGPMPQTREHILLGRQVGVPYIIVFLNKCDMVDDEELLELVEMEVRELLSQYDFPGDDTPIVRGSALKALEGDAEWEAKILELAGFLDSYIPEPERAIDKPFLLPIEDVFSISGRGTVVTGRVERGIIKVGEEVEIVGIKETQKSTCTGVEMFRKLLDEGRAGENVGVLLRGIKREEIERGQVLAKPGTIKPHTKFESEVYILSKDEGGRHTPFFKGYRPQFYFRTTDVTGTIELPEGVEMVMPGDNIKMVVTLIHPIAMDDGLRFAIREGGRTVGAGVVAKVLS

Entity 2 Entity 2 polymer

Description description	tRNA
Molecular weight formula_weight	24620.8 kDa
Source method src_method	nat
Copy count entity_count	1

Polymer Polymer

Polymer type type	polyribonucleotide
Chain IDs strand_id	B

GCCCGGAUAGCUCAGUCGGUAGAGCAGGGGAUUGAAAAUCCCCGUGXCCUUGGUUCGAUUCCGAGUCCGGGCACCA

Entity 3 Entity 3 polymer

Description description	Protein SidH
Molecular weight formula_weight	255821.6 kDa
Source method src_method	man
Copy count entity_count	1

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A

MKHHHHHHHHHHSAGLEVLFQGPMKRTIETYIIYLKEDLKIADTCKTIKDGLLKSITDKTHFSEELATYFERDNPNAPFKVNTTDPTQVAVLKKLLNALENAEKSFRAIENIDISRDRYTAMIAKDAVMVSYKAVHEIYAALQLINHSNSDIQDIVGPHIQKLLPQMALASKALGNFAPEHPEESAGAVLAGVVNMLPTEKPTESESLGKLSNLIFELPHYFEELQKLIATGASGIATKSITSAEDYQSAMIKKANETKYYFEQLSSKSGLLAIPSYLSIVKRLIAHSTDLVNAGAPLTKQAYLDAVAKLEDIKHNILPQLISELEMVEESMGLKPGLLTDPALEQMNKYYTQLAEQVDNIAKAAGVLDTVSDYSDSIGGKIVRFLAGDSKKLDVGPKLTPAPDLGVLMDDVFIQKRRSNQESRLNEARLSSEDKSVLAAANRFFDKIGSYNSIHKAWSKWSLANISQSEKDALIKEYKQFQPHFAALYPDIDKLVVDALTQPTGSNIVSRLYSSDYKQLWSSDHFKQVLSCKDSVLSSIQQSLAQSEFKAKLIEKTMSHSEETAYSMNNKTTNLTTRVQPFEPLKFTLEDDKPVEYYHKRVIAASNQILELERAQKGVAEFFNYIQKKYPHENPSFDSLDESDKEFLRKAYKTFQPQLLALKHDDINTRLVSSLTSSKPTDPPLRLTDLVSLKSGINDYLNEKISDLNQDKTTLLDKEEEAREEQYAKNPLVAKGAELEKQTLFGQMSKLKLSKSVDDFFNKKFQTYLKDNLSPEVWKQLSSNGETLDFDKIPYLEFHKDSPEVAMYKQLINSMHYMKNGLEKLESLNDYGDPNNIYHRTRFVMTTFNALVMNICFSKYYVMEAGNNPGLKAIVQEGLDLLKPLEGMPLIGDYLKTTEKQEPPKQNIITAWKKQQAVVESGLSKGPKPKTDQQLISEQLGKIQEAIDNFDGDLEVSDSAREKIKTQIGEFAKGISGLSFGPGSVKKILAALTKLETQLSNLDKESPEVTLGKLKDIHSELNAQFRAAAEYTEYHSGQKFGSYSNNISTIVSNFCNGLVSNLPLKQEPAPKVKAPEKPVTPVITGTTNPHEVVFGTKHEEFNSVYQPYLLLKRITDEFRDQNNPYKPSFDELKEEAVSYYDKIQPLLESVDPKFDKNFIAKHKESSTLLKAIDEVMSMRQRINNPESSFAKLKDLHLEGDFEKEENKEKFRQLYKEIQPYLHKIDSTYDQTQFLEGLKTAKDFSGALQRIMNEENALQQSTSLKDTSYLQLIAESLYQIPVKLNKLKAEPDTPEPSKEEIDANVKAFVEGLNGLSFGPGSVKKILSTAAKLQMQLSDIGKEGRELTMGRLKEIQAEFGTILMAAADNAEFHLGLKPGTYSRTVSERFEKFYSSLIVNLPLEKDQTGLELLIDTTSTQKRLAREMERLESVKEDTSAIDTKKSIFGTEHEQFSTLYQPYASLRHIAKDIEDGVHMNLYERTLEELKEEASNEYKKIQPYLAKINPEFTEDYISKTDGEYSLLHAIDRVFEERHKINKPSSPFDKLRDLYLDGDFEKEENKEQFLQLYAELQPHLIKINYQYDLAYFLRELQTPEDFKAATERIINDESKLQELITGLDDTKRLKVKLCEERIGYFIDLLKKQELEVGPEKIQAFKEKIFFNYIHANVNSALDAKIGSHAEQFLQFIEKDFLDKKNEILEKITIDQDMEEEIAKAIDRIAPDIINNKIESFKKLLFDSYIQSDIKNSLHNELGIYTSLFIDKISPEIHLHQSEILGNVAFDSKMGAEIGSKINAITPGILLNNNPLKEAYVDLNNTLKEINTLLDEENKKTRDNPCRNEKIAKLTSLKDRLSDLDSIPKENTVEFLKKMQEETRSSLKSLESNDALINIYDVLNSLKETIENGSDLPEIKKDKLQMISDVQNILSNFDKNPAERLNLAVQILNDSNPEVLSKTKGNFLIGEAFKGQVFTNYINTKISEQLNNELGPYGKVFLKQIMPDFIAKKSEIIKEIAIDNMETGLETQFKIHAPAIFEKNKELKAAYEQLNVHLKEVQSLIEAEEKKPKGNPCREEKIAALRSHQSQLMNTQRIPDHETLRFLQEQNKSAKSFMGKLEKYDTMISVYDSLTEIREHVSNHKSLSKEIKDEKIQEISKMEDMLKTTSKEPSIRLAEVKAHGLSDQCKNVLLKNSDNFLVSFFKTLFSKLFNIKNENETLVSSFKQRLQNIKGPEPVATPMETPENEAPLVNANITRF

Source Source

Source organism organism	;Escherichia coli 'BL21-Gold(DE3)pLysS AG' ;
NCBI taxonomy ID ncbi_taxonomy_id	866768
Host organism host_organism	Legionella pneumophila

Entity 4 Entity 4 non-polymer

Description description	MAGNESIUM ION
Molecular weight formula_weight	24.3 kDa
Source method src_method	syn
Copy count entity_count	1

Entity 5 Entity 5 non-polymer

Description description	GUANOSINE-5'-TRIPHOSPHATE
Molecular weight formula_weight	523.2 kDa
Source method src_method	syn
Copy count entity_count	1

▶

Unit-cell length a length_a	1.000 Å
Unit-cell length b length_b	1.000 Å
Unit-cell length c length_c	1.000 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	90.00 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	—

Space group space_group	P 1
Space-group number int_tables_number	1
Crystal system crystal_system	triclinic

Resolution resolution	2.70 Å
Resolution测定Method resolution_method	—
颗粒数 num_particles	367741

Cryo-EM structure of SidH from Legionella pneumophila

1. Protein Identity and Related Structures Protein Identity & Related Structures

Elongation factor Tu

State in the Current Structure

Other States of the Same Protein in the Database

Protein SidH

State in the Current Structure

Other States of the Same Protein in the Database

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

8qfs__assembly_1__model_1

8qfs__assembly_1__model_1 | I(q)

8qfs__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

冷冻电镜 EM 3D

5. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Polymer Polymer

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 polymer

Polymer Polymer

Source Source

Entity 4 Entity 4 non-polymer

Entity 5 Entity 5 non-polymer

7. Citations (1)

Cryo-EM structure of SidH from Legionella pneumophila

1. Protein Identity and Related Structures Protein Identity & Related Structures

Elongation factor Tu

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

Protein SidH

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

8qfs__assembly_1__model_1

8qfs__assembly_1__model_1 | I(q)

8qfs__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

冷冻电镜 EM 3D

5. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Polymer Polymer

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 polymer

Polymer Polymer

Source Source

Entity 4 Entity 4 non-polymer

Entity 5 Entity 5 non-polymer

7. Citations (1)