SAXSdb — 8rkv

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

TnsB

Scytonema hofmannii

State in the Current Structure

Assembly	Oligomeric State	Construct	Mutations and Modifications	Ligands, Ions and Associated Components	Method and Experimental Conditions	Structure Quality
1	Protein–DNA Homooligomer Protein × 4 DNA 6 PDB declaration: decameric（10） Consistent with all polymer counts	Chain R； UniProt 2–584 Chain S； UniProt 2–584 Chain T； UniProt 2–584 Chain U； UniProt 2–584	Not recorded	Non-target strand - LE × 1 Target strand - LE × 1 LE × 1 RE × 1 Non-target strand - RE × 1 Target strand × 1 MG MAGNESIUM ION × 2	ELECTRON MICROSCOPY cryo-EM buffer：pH 7 cryo-EM vitrification conditions：Cryogen ETHANE	Resolution 3.11 Å

Other States of the Same Protein in the Database

Each row is a biological assembly of the same UniProt protein in another PDB entry. The “Difference from current entry” column identifies evidence-level differences; no tag means the currently parsed fields agree.

Other PDB	Difference from Current Entry 8RKV	Assembly / Oligomeric State	Construct	Mutations and Modifications	Ligands, Ions and Non-polymers	Method and Experimental Conditions	Structure Quality
8RDU Conformational Landscape of the Type V-K CRISPR-associated TransposonIntegration Assembly CAST V-K composite map Deposited 2023-12-08	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different structure-quality metrics	Assembly 1 Other combination Heteromer；Protein × 25 PDB declaration: 32-meric	Chain R 2–584（583 aa） Chain S 2–584（583 aa） Chain T 2–584（583 aa） Chain U 2–584（583 aa） Chain r 2–584（583 aa） Chain s 2–584（583 aa） Chain t 2–584（583 aa） Chain u 2–584（583 aa）	Not recorded	MG MAGNESIUM ION × 17 ZN ZINC ION × 2 ATP ADENOSINE-5'-TRIPHOSPHATE × 14	ELECTRON MICROSCOPY cryo-EM buffer pH 7 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 2.30 Å

1 other PDB entries and 1 assemblies. Open the comparison page and filter oligomeric states

View Construct and Data Evidence

UniProt name	A0A979HMQ2_9CYAN
Isoform	—
PDB entities	7
Chains and sequence ranges	Author chain R； PDBConstruct 2–584； UniProt 2–584 Author chain S； PDBConstruct 2–584； UniProt 2–584 Author chain T； PDBConstruct 2–584； UniProt 2–584 Author chain U； PDBConstruct 2–584； UniProt 2–584

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	8rkv
Deposition date deposition_date	2023-12-30
Structure title title	Conformational Landscape of the Type V-K CRISPR-associated TransposonIntegration Assembly CAST V-K TnsB domain local-refinement map
Keywords keywords	CRISPR-associated Transposon genome editing transposition, DNA BINDING PROTEIN; DNA BINDING PROTEIN
Experimental Method method	ELECTRON MICROSCOPY

▼

3. SAXS Parameters (CRYSOL theoretical calculation) 3. SAXS Parameters (CRYSOL)

Radius of gyration Rg (Guinier) rg_guinier	45.76 Å
Radius of gyration Rg (electron density) rg_electron	45.46 Å
Forward intensity I(0) i0	1130480000.00
Molecular weight molecular_weight	237130.0 kDa
Excluded volume excluded_volume	279970 Å³
Envelope volume envelope_volume	417650 Å³
Hydration-shell volume shell_volume	76742 Å³
Envelope diameter envelope_diameter	162.5 Å
Shell Rg shell_rg	49.59 Å
Envelope Rg envelope_rg	44.79 Å
Shape Rg shape_rg	45.45 Å
Total Rg total_rg	45.63 Å
Total atoms total_atoms	16466
Residues n_residues	1776
Spherical-harmonic order n_harmonics	20
q range q_range	— – 0.5000 Å⁻¹
Data points n_points	101
Shell type shell_type	directional
Solvent electron density solvent_density	0.3340 e/Å³
Shell contrast contrast_shell	0.0300 e/Å³
CRYSOL version crysol_version	4.1.3

▼

4. P(r) Distance Distribution (GNOM inversion) 4. P(r) Analysis (GNOM)

Maximum dimension Dmax dmax	146.9 Å
Rg (real space) rg_real	45.75 Å
Rg uncertainty (real space) rg_real_error	1.53 Å
I(0) (real space) i0_real	1.1300e+09
I(0) uncertainty (real space) i0_real_error	2.1390e+07
Rg (reciprocal space) rg_reciprocal	45.76 Å
I(0) (reciprocal space) i0_reciprocal	1130000000.0000
Solution quality estimate total_estimate	0.5953
Solution quality rating solution_quality	REASONABLE a REASONABLE solution
P(r) peaks n_peaks	2
Primary peak position r_peak_primary	51.8 Å
Skewness Skewness skewness	0.360
Kurtosis Kurtosis kurtosis	-0.260
Angular range angular_range	— – 0.1700 Å⁻¹
Current regularization parameter α current_alpha	0.0000
Highest regularization parameter α highest_alpha	60930000.0000
Real-space data points n_real_points	35
GNOM version gnom_version	4.1.3
Quality Criteria quality_criteria	AN1: 0.000; Oscil: 0.893; Stabil: 1.000; Sysdev: 0.021; Positv: 1.000; Valcen: 0.992; Smooth: 0.000

▶

5. Crystallography and Experiment 5. Crystallography & Experiment

▶

6. Entities and Polymers Entities & Polymers (8)

Entity 1 Entity 1 polymer

Description description	Non-target strand - LE
Molecular weight formula_weight	20961.5 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	2
Atom count atom_count	16466

GTGAAGGTTCTCTTCAGTATTAATAAGGCCACTGTTAAAACGTACTATATAGACATCTCCACAAAAGG

Entity 2 Entity 2 polymer

Description description	Target strand - LE
Molecular weight formula_weight	40822.2 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	3

AATTAAATAGTCACAATGACATTAATCTGTCACCGACGACAGATAATTTGTCACTGTACACTACGCCTTTTGTGGAGATGTCTAATATCTACGTTTTAACAGTGGCCTTATTAAATGACTTCTCAACCTTCAC

Entity 3 Entity 3 polymer

Description description	LE
Molecular weight formula_weight	23238.0 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	4

AAAAAAAAAAAAAAATGTACAGTGACAAATTATCTGTCGTCGGTGACAGATTAATGTCATTGTGACTATTTAATT

Entity 4 Entity 4 polymer

Description description	RE
Molecular weight formula_weight	22876.8 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	5

AAAAAAAAAAAAAAATGTACAGTGACTAATTATATGTCGTTGTGACAAATTATTGTCATCAGTAAAATCCTTAT

Entity 5 Entity 5 polymer

Description description	Non-target strand - RE
Molecular weight formula_weight	24402.7 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	6

ATAAGGATTTTACTGATGACAATAATTTGTCACAACGACATATAATTAGTCACTGTACACGTAGAGACGTAGCAATGCT

Entity 6 Entity 6 polymer

Description description	Target strand
Molecular weight formula_weight	4560.0 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	7

AGCATTGCTACGTCT

Entity 7 Entity 7 polymer

Description description	TnsB
Molecular weight formula_weight	66592.9 kDa
Source method src_method	man
Copy count entity_count	4

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	R,S,T,U

SNSQQNPDLAVHPLAIPMEGLLGESATTLEKNVIATQLSEEAQVKLEVIQSLLEPCDRTTYGQKLREAAEKLNVSLRTVQRLVKNWEQDGLVGLTQTSRADKGKHRIGEFWENFITKTYKEGNKGSKRMTPKQVALRVEAKARELKDSKPPNYKTVLRVLAPILEKQQKAKSIRSPGWRGTTLSVKTREGKDLSVDYSNHVWQCDHTRVDVLLVDQHGEILSRPWLTTVIDTYSRCIMGINLGFDAPSSGVVALALRHAILPKRYGSEYKLHCEWGTYGKPEHFYTDGGKDFRSNHLSQIGAQLGFVCHLRDRPSEGGVVERPFKTLNDQLFSTLPGYTGSNVQERPEDAEKDARLTLRELEQLLVRYIVDRYNQSIDARMGDQTRFERWEAGLPTVPVPIPERDLDICLMKQSRRTVQRGGCLQFQNLMYRGEYLAGYAGETVNLRFDPRDITTILVYRQENNQEVFLTRAHAQGLETEQLALDEAEAASRRLRTAGKTISNQSLLQEVVDRDALVATKKSRKERQKLEQTVLRSAAVDESNRESLPSQIVEPDEVESTETVHSQYEDIEVWDYEQLREEYGF

来源 Source

来源生物 organism	Scytonema hofmannii
NCBI Class编号 ncbi_taxonomy_id	34078
宿主生物 host_organism	Escherichia coli

Entity 8 Entity 8 non-polymer

Description description	MAGNESIUM ION
Molecular weight formula_weight	24.3 kDa
Source method src_method	syn
Copy count entity_count	2

▶

8. Citations (1)

▶

Unit-cell length a length_a	1.000 Å
Unit-cell length b length_b	1.000 Å
Unit-cell length c length_c	1.000 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	90.00 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	—

Space group space_group	P 1
Space-group number int_tables_number	1
Crystal system crystal_system	—

Resolution resolution	3.11 Å
Resolution测定方法 resolution_method	—
颗粒数 num_particles	154000

fit	/app/data/saxs_computation/rk/8rkv/8rkv.fit
pddf	/app/data/pr_computation/rk/8rkv/8rkv.pr.out
profile	/app/data/saxs_computation/rk/8rkv/8rkv.dat

Conformational Landscape of the Type V-K CRISPR-associated TransposonIntegration Assembly CAST V-K TnsB domain local-refinement map

1. Protein Identity and Related Structures Protein Identity & Related Structures

TnsB

State in the Current Structure

Other States of the Same Protein in the Database

SAXS scattering curve SAXS Profile

P(r) Distance Distribution P(r) Distribution

2. Structure Basics 2. Structure Basics

3. SAXS Parameters (CRYSOL theoretical calculation) 3. SAXS Parameters (CRYSOL)

4. P(r) Distance Distribution (GNOM inversion) 4. P(r) Analysis (GNOM)

5. Crystallography and Experiment 5. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

冷冻电镜 EM 3D

6. Entities and Polymers Entities & Polymers (8)

Entity 1 Entity 1 polymer

Polymer Polymer

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 polymer

Polymer Polymer

Entity 4 Entity 4 polymer

Polymer Polymer

Entity 5 Entity 5 polymer

Polymer Polymer

Entity 6 Entity 6 polymer

Polymer Polymer

Entity 7 Entity 7 polymer

Polymer Polymer

来源 Source

Entity 8 Entity 8 non-polymer

8. Citations (1)

9. Files and Curves (10)

Files (7)

Curves (3)