8zp4

Cryo-EM structure of origin recognition complex (Orc1 to 5) with ARS1 DNA bound

Method: ELECTRON MICROSCOPY

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

Origin recognition complex subunit 1

Saccharomyces cerevisiae S288C

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–DNA	Heteromer	Protein 5 DNA 2	Origin recognition complex subunit 2 × 1 （P32833） Origin recognition complex subunit 3 × 1 （P54790） Origin recognition complex subunit 4 × 1 （P54791） DNA (31-MER) × 1 DNA (31-MER) × 1 Origin recognition complex subunit 5 × 1 （P50874） PHOSPHOTHIOPHOSPHORIC ACID-ADENYLATE ESTER × 3 MAGNESIUM ION × 3	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	ORC1_YEAST
Isoform	—
PDB entities	1
Chains and sequence ranges	Author chain A； PDBConstruct 1–914； UniProt 1–914

Origin recognition complex subunit 2

Saccharomyces cerevisiae S288C

UniProt P32833

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–DNA	Heteromer	Protein 5 DNA 2	Origin recognition complex subunit 1 × 1 （P54784） Origin recognition complex subunit 3 × 1 （P54790） Origin recognition complex subunit 4 × 1 （P54791） DNA (31-MER) × 1 DNA (31-MER) × 1 Origin recognition complex subunit 5 × 1 （P50874） PHOSPHOTHIOPHOSPHORIC ACID-ADENYLATE ESTER × 3 MAGNESIUM ION × 3	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	ORC2_YEAST
Isoform	—
PDB entities	2
Chains and sequence ranges	Author chain B； PDBConstruct 1–620； UniProt 1–620

Origin recognition complex subunit 3

Saccharomyces cerevisiae S288C

UniProt P54790

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–DNA	Heteromer	Protein 5 DNA 2	Origin recognition complex subunit 1 × 1 （P54784） Origin recognition complex subunit 2 × 1 （P32833） Origin recognition complex subunit 4 × 1 （P54791） DNA (31-MER) × 1 DNA (31-MER) × 1 Origin recognition complex subunit 5 × 1 （P50874） PHOSPHOTHIOPHOSPHORIC ACID-ADENYLATE ESTER × 3 MAGNESIUM ION × 3	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	ORC3_YEAST
Isoform	—
PDB entities	3
Chains and sequence ranges	Author chain C； PDBConstruct 1–616； UniProt 1–616

Origin recognition complex subunit 4

Saccharomyces cerevisiae S288C

UniProt P54791

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–DNA	Heteromer	Protein 5 DNA 2	Origin recognition complex subunit 1 × 1 （P54784） Origin recognition complex subunit 2 × 1 （P32833） Origin recognition complex subunit 3 × 1 （P54790） DNA (31-MER) × 1 DNA (31-MER) × 1 Origin recognition complex subunit 5 × 1 （P50874） PHOSPHOTHIOPHOSPHORIC ACID-ADENYLATE ESTER × 3 MAGNESIUM ION × 3	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	ORC4_YEAST
Isoform	—
PDB entities	4
Chains and sequence ranges	Author chain D； PDBConstruct 1–529； UniProt 1–529

Origin recognition complex subunit 5

Saccharomyces cerevisiae S288C

UniProt P50874

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–DNA	Heteromer	Protein 5 DNA 2	Origin recognition complex subunit 1 × 1 （P54784） Origin recognition complex subunit 2 × 1 （P32833） Origin recognition complex subunit 3 × 1 （P54790） Origin recognition complex subunit 4 × 1 （P54791） DNA (31-MER) × 1 DNA (31-MER) × 1 PHOSPHOTHIOPHOSPHORIC ACID-ADENYLATE ESTER × 3 MAGNESIUM ION × 3	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	ORC5_YEAST
Isoform	—
PDB entities	7
Chains and sequence ranges	Author chain E； PDBConstruct 1–479； UniProt 1–479

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	8zp4
Deposition date deposition_date	2024-05-29
Last revision last_revision	2025-04-16
Structure title title	Cryo-EM structure of origin recognition complex (Orc1 to 5) with ARS1 DNA bound
Keywords keywords	origin recognition complex, REPLICATION; REPLICATION
Experimental Method method	ELECTRON MICROSCOPY

▼

3. Official assembly/model SAXS Official SAXS Profiles

This page reads only the latest assembly calculations. Every curve maps to an explicit PDB entry, official biological assembly and coordinate model.

8zp4__assembly_1__model_1

Assembly 1 · Model 1 · CRYSOL 4.1.3-1-20251215 (887e7ef)

Download this curve (.dat)

8zp4__assembly_1__model_1 | I(q)

100 plotted points; both axes use logarithmic scales.

8zp4__assembly_1__model_1 | P(r) · Pending

P(r) will be calculated and displayed separately for the same assembly/model.

Rg（Guinier）	43.89 Å
Rg (electron density)	43.91 Å
Total Rg	44.05 Å
Atom count	20029
Residues	2348
Excluded volume	355550 Å³
Maximum q	0.500 Å⁻¹

Assembly	Model	Structure unit	Oligomeric description	Status	CRYSOL	Actions
1	1	`8zp4__assembly_1__model_1`	heptameric （7）	Success	4.1.3-1-20251215 (887e7ef)	View Download

▶

4. Crystallography and Experiment 4. Crystallography & Experiment

▶

5. Entities and Polymers Entities & Polymers (9)

Entity 1 Entity 1 polymer

Description description	Origin recognition complex subunit 1
Molecular weight formula_weight	104546.2 kDa
Source method src_method	man
Copy count entity_count	1

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A
Atom count atom_count	20029

MAKTLKDLQGWEIITTDEQGNIIDGGQKRLRRRGAKTEHYLKRSSDGIKLGRGDSVVMHNEAAGTYSVYMIQELRLNTLNNVVELWALTYLRWFEVNPLAHYRQFNPDANILNRPLNYYNKLFSETANKNELYLTAELAELQLFNFIRVANVMDGSKWEVLKGNVDPERDFTVRYICEPTGEKFVDINIEDVKAYIKKVEPREAQEYLKDLTLPSKKKEIKRGPQKKDKATQTAQISDAETRATDITDNEDGNEDESSDYESPSDIDVSEDMDSGEISADELEEEEDEEEDEDEEEKEARHTNSPRKRGRKIKLGKDDIDASVQPPPKKRGRKPKDPSKPRQMLLISSCRANNTPVIRKFTKKNVARAKKKYTPFSKRFKSIAAIPDLTSLPEFYGNSSELMASRFENKLKTTQKHQIVETIFSKVKKQLNSSYVKEEILKSANFQDYLPARENEFASIYLSAYSAIESDSATTIYVAGTPGVGKTLTVREVVKELLSSSAQREIPDFLYVEINGLKMVKPTDCYETLWNKVSGERLTWAASMESLEFYFKRVPKNKKKTIVVLLDELDAMVTKSQDIMYNFFNWTTYENAKLIVIAVANTMDLPERQLGNKITSRIGFTRIMFTGYTHEELKNIIDLRLKGLNDSFFYVDTKTGNAILIDAAGNDTTVKQTLPEDVRKVRLRMSADAIEIASRKVASVSGDARRALKVCKRAAEIAEKHYMAKHGYGYDGKTVIEDENEEQIYDDEDKDLIESNKAKDDNDDDDDNDGVQTVHITHVMKALNETLNSHVITFMTRLSFTAKLFIYALLNLMKKNGSQEQELGDIVDEIKLLIEVNGSNKFVMEIAKTLFQQGSDNISEQLRIISWDFVLNQLLDAGILFKQTMKNDRICCVKLNISVEEAKRAMNEDETLRNL

Source Source

Source organism organism	Saccharomyces cerevisiae S288C
NCBI taxonomy ID ncbi_taxonomy_id	559292
Host organism host_organism	Saccharomyces cerevisiae

Entity 2 Entity 2 polymer

Description description	Origin recognition complex subunit 2
Molecular weight formula_weight	71342.2 kDa
Source method src_method	man
Copy count entity_count	1

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	B

MLNGEDFVEHNDILSSPAKSRNVTPKRVDPHGERQLRRIHSSKKNLLERISLVGNERKNTSPDPALKPKTPSKAPRKRGRPRKIQEELTDRIKKDEKDTISSKKKRKLDKDTSGNVNEESKTSNNKQVMEKTGIKEKREREKIQVATTTYEDNVTPQTDDNFVSNSPEPPEPATPSKKSLTTNHDFTSPLKQIIMNNLKEYKDSTSPGKLTLSRNFTPTPVPKNKKLYQTSETKSASSFLDTFEGYFDQRKIVRTNAKSRHTMSMAPDVTREEFSLVSNFFNENFQKRPRQKLFEIQKKMFPQYWFELTQGFSLLFYGVGSKRNFLEEFAIDYLSPKIAYSQLAYENELQQNKPVNSIPCLILNGYNPSCNYRDVFKEITDLLVPAELTRSETKYWGNHVILQIQKMIDFYKNQPLDIKLILVVHNLDGPSIRKNTFQTMLSFLSVIRQIAIVASTDHIYAPLLWDNMKAQNYNFVFHDISNFEPSTVESTFQDVMKMGKSDTSSGAEGAKYVLQSLTVNSKKMYKLLIETQMQNMGNLSANTGPKRGTQRTGVELKLFNHLCAADFIASNEIALRSMLREFIEHKMANITKNNSGMEIIWVPYTYAELEKLLKTVLNTL

Source Source

Source organism organism	Saccharomyces cerevisiae S288C
NCBI taxonomy ID ncbi_taxonomy_id	559292
Host organism host_organism	Saccharomyces cerevisiae

Entity 3 Entity 3 polymer

Description description	Origin recognition complex subunit 3
Molecular weight formula_weight	72161.8 kDa
Source method src_method	man
Copy count entity_count	1

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	C

MSDLNQSKKMNVSEFADAQRSHYTVYPSLPQSNKNDKHIPFVKLLSGKESEVNVEKRWELYHQLHSHFHDQVDHIIDNIEADLKAEISDLLYSETTQKRRCFNTIFLLGSDSTTKIELKDESSRYNVLIELTPKESPNVRMMLRRSMYKLYSAADAEEHPTIKYEDINDEDGDFTEQNNDVSYDLSLVENFKRLFGKDLAMVFNFKDVDSINFNTLDNFIILLKSAFKYDHVKISLIFNINTNLSNIEKNLRQSTIRLLKRNYHKLDVSSNKGFKYGNQIFQSFLDTVDGKLNLSDRFVEFILSKMANNTNHNLQLLTKMLDYSLMSYFFQNAFSVFIDPVNVDFLNDDYLKILSRCPTFMFFVEGLIKQHAPADEILSLLTNKNRGLEEFFVEFLVRENPINGHAKFVARFLEEELNITNFNLIELYHNLLIGKLDSYLDRWSACKEYKDRLHFEPIDTIFQELFTLDNRSGLLTQSIFPSYKSNIEDNLLSWEQVLPSLDKENYDTLSGDLDKIMAPVLGQLFKLYREANMTINIYDFYIAFRETLPKEEILNFIRKDPSNTKLLELAETPDAFDKVALILFMQAIFAFENMGLIKFQSTKSYDLVEKCVWRGI

Source Source

Source organism organism	Saccharomyces cerevisiae S288C
NCBI taxonomy ID ncbi_taxonomy_id	559292
Host organism host_organism	Saccharomyces cerevisiae

Entity 4 Entity 4 polymer

Description description	Origin recognition complex subunit 4
Molecular weight formula_weight	60772.2 kDa
Source method src_method	man
Copy count entity_count	1

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	D

MTISEARLSPQVNLLPIKRHSNEEVEETAAILKKRTIDNEKCKDSDPGFGSLQRRLLQQLYGTLPTDEKIIFTYLQDCQQEIDRIIKQSIIQKESHSVILVGPRQSYKTYLLDYELSLLQQSYKEQFITIRLNGFIHSEQTAINGIATQLEQQLQKIHGSEEKIDDTSLETISSGSLTEVFEKILLLLDSTTKTRNEDSGEVDRESITKITVVFIFDEIDTFAGPVRQTLLYNLFDMVEHSRVPVCIFGCTTKLNILEYLEKRVKSRFSQRVIYMPQIQNLDDMVDAVRNLLTVRSEISPWVSQWNETLEKELSDPRSNLNRHIRMNFETFRSLPTLKNSIIPLVATSKNFGSLCTAIKSCSFLDIYNKNQLSNNLTGRLQSLSDLELAILISAARVALRAKDGSFNFNLAYAEYEKMIKAINSRIPTVAPTTNVGTGQSTFSIDNTIKLWLKKDVKNVWENLVQLDFFTEKSAVGLRDNATAAFYASNYQFQGTMIPFDLRSYQMQIILQELRRIIPKSNMYYSWTQL

Source Source

Source organism organism	Saccharomyces cerevisiae S288C
NCBI taxonomy ID ncbi_taxonomy_id	559292
Host organism host_organism	Saccharomyces cerevisiae

Entity 5 Entity 5 polymer

Description description	DNA (31-MER)
Molecular weight formula_weight	23708.3 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	G

TACAGATTTTATGTTTAGATCTTTTATGCTTGCTTTTCAAAAGGCCTGCAGGCAAGTGCACAAACAATACTTAAATA

Entity 6 Entity 6 polymer

Description description	DNA (31-MER)
Molecular weight formula_weight	23766.3 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	H

TATTTAAGTATTGTTTGTGCACTTGCCTGCAGGCCTTTTGAAAAGCAAGCATAAAAGATCTAAACATAAAATCTGTA

Entity 7 Entity 7 polymer

Description description	Origin recognition complex subunit 5
Molecular weight formula_weight	55347.2 kDa
Source method src_method	man
Copy count entity_count	1

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	E

MNVTTPEVAFREYQTNCLASYISADPDITPSNLILQGYSGTGKTYTLKKYFNANPNLHAVWLEPVELVSWKPLLQAIARTVQYKLKTLYPNIPTTDYDPLQVEEPFLLVKTLHNIFVQYESLQEKTCLFLILDGFDSLQDLDAALFNKYIKLNELLPKDSKINIKFIYTMLETSFLQRYSTHCIPTVMFPRYNVDEVSTILVMSRCGELMEDSCLRKRIIEEQITDCTDDQFQNVAANFIHLIVQAFHSYTGNDIFALNDLIDFKWPKYVSRITKENIFEPLALYKSAIKLFLSTDDNLSENGQGESAITTNRDDLENSQTYDLSIISKYLLIASYICSYLEPRYDASIFSRKTRIIQGRAAYGRRKKKEVNPRYLQPSLFAIERLLAIFQAIFPIQGKAESGSLSALREESLMKANIEVFQNLSELHTLKLIATTMNKNIDYLSPKVRWKVNVPWEIIKEISESVHFNISDYFSDIHE

Source Source

Source organism organism	Saccharomyces cerevisiae S288C
NCBI taxonomy ID ncbi_taxonomy_id	559292
Host organism host_organism	Saccharomyces cerevisiae

Entity 8 Entity 8 non-polymer

Description description	PHOSPHOTHIOPHOSPHORIC ACID-ADENYLATE ESTER
Molecular weight formula_weight	523.2 kDa
Source method src_method	syn
Copy count entity_count	3

Entity 9 Entity 9 non-polymer

Description description	MAGNESIUM ION
Molecular weight formula_weight	24.3 kDa
Source method src_method	syn
Copy count entity_count	3

▶

Unit-cell length a length_a	1.000 Å
Unit-cell length b length_b	1.000 Å
Unit-cell length c length_c	1.000 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	90.00 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	—

Space group space_group	P 1
Space-group number int_tables_number	1
Crystal system crystal_system	—

Resolution resolution	3.330 Å
Low-resolution limit resolution_low	— Å
R factor r_factor	—
R_work r_work	—
R_free r_free	—

Resolution resolution	3.33 Å
Resolution测定Method resolution_method	—
颗粒数 num_particles	80078

Cryo-EM structure of origin recognition complex (Orc1 to 5) with ARS1 DNA bound

1. Protein Identity and Related Structures Protein Identity & Related Structures

Origin recognition complex subunit 1

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

Origin recognition complex subunit 2

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

Origin recognition complex subunit 3

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

Origin recognition complex subunit 4

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

Origin recognition complex subunit 5

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

8zp4__assembly_1__model_1

8zp4__assembly_1__model_1 | I(q)

8zp4__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

冷冻电镜 EM 3D

5. Entities and Polymers Entities & Polymers (9)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Source Source

Entity 3 Entity 3 polymer

Polymer Polymer

Source Source

Entity 4 Entity 4 polymer

Polymer Polymer

Source Source

Entity 5 Entity 5 polymer

Polymer Polymer

Entity 6 Entity 6 polymer

Polymer Polymer

Entity 7 Entity 7 polymer

Polymer Polymer

Source Source

Entity 8 Entity 8 non-polymer

Entity 9 Entity 9 non-polymer

7. Citations (1)