9d6o

Loop-Deleted DNA Polymerase Theta Polymerase Domain in Complex with a dsDNA Overhang and an Allosteric Inhibitor

Method: X-RAY DIFFRACTION D_max: 91.8 Å Quality: GOOD

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

DNA polymerase theta

Homo sapiens

State in the Current Structure

Assembly	Oligomeric State	Construct	Mutations and Modifications	Ligands, Ions and Associated Components	Method and Experimental Conditions	Structure Quality
1	Protein–DNA Monomer Protein × 1 DNA 2 PDB declaration: trimeric（3） Consistent with all polymer counts	Chain A； UniProt 1819–2590	Not recorded	DNA Template × 1 DNA Primer × 1 MG MAGNESIUM ION × 1 DG3 2'-3'-DIDEOXYGUANOSINE-5'-TRIPHOSPHATE × 1 A1A2D 2-[3-(2-hydroxyethyl)-2-oxoimidazolidin-1-yl]-4,6-bis(trifluoromethyl)phenyl (4-fluorophenyl)(methyl)carbamate × 1	X-RAY DIFFRACTION X-ray crystallization conditions：VAPOR DIFFUSION, HANGING DROP；pH 7.5；277.15 K；0.1M Bis Tris Propane pH 7.5, 18% (w/v) PEG 3350, 0.29M Sodium Tartrate	Resolution 3.31 Å R-free 0.234

Other States of the Same Protein in the Database

Each row is a biological assembly of the same UniProt protein in another PDB entry. The “Difference from current entry” column identifies evidence-level differences; no tag means the currently parsed fields agree.

Other PDB	Difference from Current Entry 9D6O	Assembly / Oligomeric State	Construct	Mutations and Modifications	Ligands, Ions and Non-polymers	Method and Experimental Conditions	Structure Quality
4X0P Ternary complex of human DNA polymerase theta C-terminal domain binding ddATP opposite a tetrahydrofuran AP site analog Deposited 2014-11-21	Different construct Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: trimeric	Chain A 1792–2590（799 aa） Fragment：UNP residues 1792-2590	Not recorded	GOL GLYCEROL × 2 CA CALCIUM ION × 1 DDS 2',3'-dideoxyadenosine triphosphate × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 8；291 K；PEG 2000mme, MPD, potassium chloride, calcium chloride, TRIS buffer, glycerol	Resolution 3.91 Å R-free 0.302
4X0P Ternary complex of human DNA polymerase theta C-terminal domain binding ddATP opposite a tetrahydrofuran AP site analog Deposited 2014-11-21	Different construct Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 2 Protein–DNA Monomer；Protein × 1 PDB declaration: trimeric	Chain B 1792–2590（799 aa） Fragment：UNP residues 1792-2590	Not recorded	GOL GLYCEROL × 2 CA CALCIUM ION × 1 DDS 2',3'-dideoxyadenosine triphosphate × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 8；291 K；PEG 2000mme, MPD, potassium chloride, calcium chloride, TRIS buffer, glycerol	Resolution 3.91 Å R-free 0.302
4X0P Ternary complex of human DNA polymerase theta C-terminal domain binding ddATP opposite a tetrahydrofuran AP site analog Deposited 2014-11-21	Different construct Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 3 Protein–DNA Monomer；Protein × 1 PDB declaration: trimeric	Chain C 1792–2590（799 aa） Fragment：UNP residues 1792-2590	Not recorded	GOL GLYCEROL × 2 CA CALCIUM ION × 1 DDS 2',3'-dideoxyadenosine triphosphate × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 8；291 K；PEG 2000mme, MPD, potassium chloride, calcium chloride, TRIS buffer, glycerol	Resolution 3.91 Å R-free 0.302
4X0P Ternary complex of human DNA polymerase theta C-terminal domain binding ddATP opposite a tetrahydrofuran AP site analog Deposited 2014-11-21	Different construct Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 4 Protein–DNA Monomer；Protein × 1 PDB declaration: trimeric	Chain D 1792–2590（799 aa） Fragment：UNP residues 1792-2590	Not recorded	GOL GLYCEROL × 2 CA CALCIUM ION × 1 DDS 2',3'-dideoxyadenosine triphosphate × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 8；291 K；PEG 2000mme, MPD, potassium chloride, calcium chloride, TRIS buffer, glycerol	Resolution 3.91 Å R-free 0.302
4X0Q Ternary complex of human DNA polymerase theta C-terminal domain binding ddGTP opposite dCMP Deposited 2014-11-22	Different construct Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: trimeric	Chain A 1819–2590（772 aa） Fragment：UNP residues 1815-2590	Not recorded	GOL GLYCEROL × 2 MG MAGNESIUM ION × 1 DG3 2'-3'-DIDEOXYGUANOSINE-5'-TRIPHOSPHATE × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 8；291 K；PEG 2000mme, MPD, potassium chloride, TRIS buffer, glycerol	Resolution 3.90 Å R-free 0.316
4X0Q Ternary complex of human DNA polymerase theta C-terminal domain binding ddGTP opposite dCMP Deposited 2014-11-22	Different construct Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 2 Protein–DNA Monomer；Protein × 1 PDB declaration: trimeric	Chain B 1819–2590（772 aa） Fragment：UNP residues 1815-2590	Not recorded	GOL GLYCEROL × 2 MG MAGNESIUM ION × 1 DG3 2'-3'-DIDEOXYGUANOSINE-5'-TRIPHOSPHATE × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 8；291 K；PEG 2000mme, MPD, potassium chloride, TRIS buffer, glycerol	Resolution 3.90 Å R-free 0.316
5A9F Crystal structure of the Helicase domain of human DNA polymerase theta in complex with ADP Deposited 2015-07-21	Different construct Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein homooligomer Homooligomer；Protein × 4 PDB declaration: tetrameric	Chain A 67–894（828 aa） Fragment：HELICASE DOMAIN, RESIDUES 67-894	Not recorded	ADP ADENOSINE-5'-DIPHOSPHATE × 4 K POTASSIUM ION × 4 MG MAGNESIUM ION × 4	X-RAY DIFFRACTION X-ray crystallization conditions 19% PEG 3350, 0.2M POTASSIUM CITRATE TRIBASIC	Resolution 3.20 Å R-free 0.273
5A9J Crystal structure of the Helicase domain of human DNA polymerase theta, apo-form Deposited 2015-07-21	Different construct Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain A 1–894（894 aa） Fragment：HELICASE DOMAIN, UNP RESIDUES 1-894	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions 0.2M NACL, 20% PEG 6K, 10% ETHYLENE GLYCOL, 0.1 M HEPES PH 7.0	Resolution 3.55 Å R-free 0.265
5A9J Crystal structure of the Helicase domain of human DNA polymerase theta, apo-form Deposited 2015-07-21	Different construct Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 2 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain B 1–894（894 aa） Fragment：HELICASE DOMAIN, UNP RESIDUES 1-894	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions 0.2M NACL, 20% PEG 6K, 10% ETHYLENE GLYCOL, 0.1 M HEPES PH 7.0	Resolution 3.55 Å R-free 0.265
5A9J Crystal structure of the Helicase domain of human DNA polymerase theta, apo-form Deposited 2015-07-21	Different construct Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 3 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain C 1–894（894 aa） Fragment：HELICASE DOMAIN, UNP RESIDUES 1-894	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions 0.2M NACL, 20% PEG 6K, 10% ETHYLENE GLYCOL, 0.1 M HEPES PH 7.0	Resolution 3.55 Å R-free 0.265
5A9J Crystal structure of the Helicase domain of human DNA polymerase theta, apo-form Deposited 2015-07-21	Different construct Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 4 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain D 1–894（894 aa） Fragment：HELICASE DOMAIN, UNP RESIDUES 1-894	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions 0.2M NACL, 20% PEG 6K, 10% ETHYLENE GLYCOL, 0.1 M HEPES PH 7.0	Resolution 3.55 Å R-free 0.265
5AGA Crystal structure of the Helicase domain of human DNA polymerase theta in complex with AMPPNP Deposited 2015-01-29	Different construct Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein homooligomer Homooligomer；Protein × 4 PDB declaration: tetrameric	Chain A 67–894（828 aa） Fragment：HELICASE DOMAIN, RESIDUES 67-894	Not recorded	ANP PHOSPHOAMINOPHOSPHONIC ACID-ADENYLATE ESTER × 4 FLC CITRATE ANION × 4 K POTASSIUM ION × 4 MG MAGNESIUM ION × 4	X-RAY DIFFRACTION X-ray crystallization conditions 19% PEG 3350, 0.2M POTASSIUM CITRATE TRIBASIC	Resolution 2.90 Å R-free 0.264
5AGA Crystal structure of the Helicase domain of human DNA polymerase theta in complex with AMPPNP Deposited 2015-01-29	Different construct Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 2 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain A 67–894（828 aa） Fragment：HELICASE DOMAIN, RESIDUES 67-894	Not recorded	ANP PHOSPHOAMINOPHOSPHONIC ACID-ADENYLATE ESTER × 1 FLC CITRATE ANION × 1 K POTASSIUM ION × 1 MG MAGNESIUM ION × 1	X-RAY DIFFRACTION X-ray crystallization conditions 19% PEG 3350, 0.2M POTASSIUM CITRATE TRIBASIC	Resolution 2.90 Å R-free 0.264
6XBU polymerase domain of polymerase-theta Deposited 2020-06-07	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Other combination Homooligomer；Protein × 2 PDB declaration: hexameric	Chain A 1819–1860（42 aa） Chain A 1068–1089（22 aa） Chain A 1935–2145（211 aa） Chain A 2176–2260（85 aa） Chain A 2307–2512（206 aa） Chain A 2527–2590（64 aa）	Not recorded	DG3 2'-3'-DIDEOXYGUANOSINE-5'-TRIPHOSPHATE × 2	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 8；291 K；20% (w/v) Ethanol	Resolution 3.29 Å R-free 0.281
7ZUS Crystal structure of ternary complex of Pol theta polymerase domain Deposited 2022-05-13	Different construct Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: trimeric	Chain AAA 1820–2590（771 aa）	Not recorded	MG MAGNESIUM ION × 1 DG3 2'-3'-DIDEOXYGUANOSINE-5'-TRIPHOSPHATE × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 8.9；285 K；15% (w/v) PEG 3350, 0.1 M Bis-Tris propane pH 8.9, 0.2 M sodium citrate tribasic dihydrate.	Resolution 2.26 Å R-free 0.238
7ZUS Crystal structure of ternary complex of Pol theta polymerase domain Deposited 2022-05-13	Different construct Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 2 Protein–DNA Monomer；Protein × 1 PDB declaration: trimeric	Chain BBB 1820–2590（771 aa）	Not recorded	MG MAGNESIUM ION × 1 DG3 2'-3'-DIDEOXYGUANOSINE-5'-TRIPHOSPHATE × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 8.9；285 K；15% (w/v) PEG 3350, 0.1 M Bis-Tris propane pH 8.9, 0.2 M sodium citrate tribasic dihydrate.	Resolution 2.26 Å R-free 0.238
7ZUS Crystal structure of ternary complex of Pol theta polymerase domain Deposited 2022-05-13	Different construct Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 3 Protein–DNA Monomer；Protein × 1 PDB declaration: trimeric	Chain CCC 1820–2590（771 aa）	Not recorded	MG MAGNESIUM ION × 1 DG3 2'-3'-DIDEOXYGUANOSINE-5'-TRIPHOSPHATE × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 8.9；285 K；15% (w/v) PEG 3350, 0.1 M Bis-Tris propane pH 8.9, 0.2 M sodium citrate tribasic dihydrate.	Resolution 2.26 Å R-free 0.238
7ZX0 Crystal structure of Pol theta polymerase domain in complex with compound 5 Deposited 2022-05-19	Different construct Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: trimeric	Chain AAA 1820–2590（771 aa）	Not recorded	MG MAGNESIUM ION × 1 DG3 2'-3'-DIDEOXYGUANOSINE-5'-TRIPHOSPHATE × 1 K7X 2-[5-bromanyl-3-cyano-6-methyl-4-(trifluoromethyl)pyridin-2-yl]oxy-~{N}-ethyl-~{N}-(3-methylphenyl)ethanamide × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 8.9；285 K；15% (w/v) PEG 3350, 0.1 M Bis-Tris propane pH 8.9, 0.2 M sodium citrate tribasic dihydrate	Resolution 2.99 Å R-free 0.252
7ZX0 Crystal structure of Pol theta polymerase domain in complex with compound 5 Deposited 2022-05-19	Different construct Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 2 Protein–DNA Monomer；Protein × 1 PDB declaration: trimeric	Chain BBB 1820–2590（771 aa）	Not recorded	MG MAGNESIUM ION × 1 DG3 2'-3'-DIDEOXYGUANOSINE-5'-TRIPHOSPHATE × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 8.9；285 K；15% (w/v) PEG 3350, 0.1 M Bis-Tris propane pH 8.9, 0.2 M sodium citrate tribasic dihydrate	Resolution 2.99 Å R-free 0.252
7ZX0 Crystal structure of Pol theta polymerase domain in complex with compound 5 Deposited 2022-05-19	Different construct Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 3 Protein–DNA Monomer；Protein × 1 PDB declaration: trimeric	Chain CCC 1820–2590（771 aa）	Not recorded	MG MAGNESIUM ION × 1 DG3 2'-3'-DIDEOXYGUANOSINE-5'-TRIPHOSPHATE × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 8.9；285 K；15% (w/v) PEG 3350, 0.1 M Bis-Tris propane pH 8.9, 0.2 M sodium citrate tribasic dihydrate	Resolution 2.99 Å R-free 0.252
7ZX0 Crystal structure of Pol theta polymerase domain in complex with compound 5 Deposited 2022-05-19	Different construct Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 4 Protein–DNA Monomer；Protein × 1 PDB declaration: trimeric	Chain DDD 1820–2590（771 aa）	Not recorded	MG MAGNESIUM ION × 1 DG3 2'-3'-DIDEOXYGUANOSINE-5'-TRIPHOSPHATE × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 8.9；285 K；15% (w/v) PEG 3350, 0.1 M Bis-Tris propane pH 8.9, 0.2 M sodium citrate tribasic dihydrate	Resolution 2.99 Å R-free 0.252
7ZX0 Crystal structure of Pol theta polymerase domain in complex with compound 5 Deposited 2022-05-19	Different construct Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 5 Protein–DNA Monomer；Protein × 1 PDB declaration: trimeric	Chain EEE 1820–2590（771 aa）	Not recorded	MG MAGNESIUM ION × 1 DG3 2'-3'-DIDEOXYGUANOSINE-5'-TRIPHOSPHATE × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 8.9；285 K；15% (w/v) PEG 3350, 0.1 M Bis-Tris propane pH 8.9, 0.2 M sodium citrate tribasic dihydrate	Resolution 2.99 Å R-free 0.252
7ZX0 Crystal structure of Pol theta polymerase domain in complex with compound 5 Deposited 2022-05-19	Different construct Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 6 Protein–DNA Monomer；Protein × 1 PDB declaration: trimeric	Chain FFF 1820–2590（771 aa）	Not recorded	MG MAGNESIUM ION × 1 DG3 2'-3'-DIDEOXYGUANOSINE-5'-TRIPHOSPHATE × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 8.9；285 K；15% (w/v) PEG 3350, 0.1 M Bis-Tris propane pH 8.9, 0.2 M sodium citrate tribasic dihydrate	Resolution 2.99 Å R-free 0.252
7ZX1 Crystal structure of Pol theta polymerase domain in complex with compound 22 Deposited 2022-05-19	Different construct Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: trimeric	Chain AAA 1820–2590（771 aa）	Not recorded	MG MAGNESIUM ION × 1 DG3 2'-3'-DIDEOXYGUANOSINE-5'-TRIPHOSPHATE × 1 K8I (2~{S},3~{R})-1-[3-cyano-6-methyl-4-(trifluoromethyl)pyridin-2-yl]-~{N}-methyl-~{N}-(3-methylphenyl)-3-oxidanyl-pyrrolidine-2-carboxamide × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；285 K；15% (w/v) PEG 3350, 0.1 M Bis-Tris propane pH 8.9, 0.2 M sodium citrate tribasic dihydrate	Resolution 2.83 Å R-free 0.260
7ZX1 Crystal structure of Pol theta polymerase domain in complex with compound 22 Deposited 2022-05-19	Different construct Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 2 Protein–DNA Monomer；Protein × 1 PDB declaration: trimeric	Chain BBB 1820–2590（771 aa）	Not recorded	MG MAGNESIUM ION × 1 DG3 2'-3'-DIDEOXYGUANOSINE-5'-TRIPHOSPHATE × 1 K8I (2~{S},3~{R})-1-[3-cyano-6-methyl-4-(trifluoromethyl)pyridin-2-yl]-~{N}-methyl-~{N}-(3-methylphenyl)-3-oxidanyl-pyrrolidine-2-carboxamide × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；285 K；15% (w/v) PEG 3350, 0.1 M Bis-Tris propane pH 8.9, 0.2 M sodium citrate tribasic dihydrate	Resolution 2.83 Å R-free 0.260
7ZX1 Crystal structure of Pol theta polymerase domain in complex with compound 22 Deposited 2022-05-19	Different construct Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 3 Protein–DNA Monomer；Protein × 1 PDB declaration: trimeric	Chain CCC 1820–2590（771 aa）	Not recorded	MG MAGNESIUM ION × 1 DG3 2'-3'-DIDEOXYGUANOSINE-5'-TRIPHOSPHATE × 1 K8I (2~{S},3~{R})-1-[3-cyano-6-methyl-4-(trifluoromethyl)pyridin-2-yl]-~{N}-methyl-~{N}-(3-methylphenyl)-3-oxidanyl-pyrrolidine-2-carboxamide × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；285 K；15% (w/v) PEG 3350, 0.1 M Bis-Tris propane pH 8.9, 0.2 M sodium citrate tribasic dihydrate	Resolution 2.83 Å R-free 0.260
7ZX1 Crystal structure of Pol theta polymerase domain in complex with compound 22 Deposited 2022-05-19	Different construct Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 4 Protein–DNA Monomer；Protein × 1 PDB declaration: trimeric	Chain DDD 1820–2590（771 aa）	Not recorded	MG MAGNESIUM ION × 1 DG3 2'-3'-DIDEOXYGUANOSINE-5'-TRIPHOSPHATE × 1 K8I (2~{S},3~{R})-1-[3-cyano-6-methyl-4-(trifluoromethyl)pyridin-2-yl]-~{N}-methyl-~{N}-(3-methylphenyl)-3-oxidanyl-pyrrolidine-2-carboxamide × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；285 K；15% (w/v) PEG 3350, 0.1 M Bis-Tris propane pH 8.9, 0.2 M sodium citrate tribasic dihydrate	Resolution 2.83 Å R-free 0.260
7ZX1 Crystal structure of Pol theta polymerase domain in complex with compound 22 Deposited 2022-05-19	Different construct Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 5 Protein–DNA Monomer；Protein × 1 PDB declaration: trimeric	Chain EEE 1820–2590（771 aa）	Not recorded	MG MAGNESIUM ION × 1 DG3 2'-3'-DIDEOXYGUANOSINE-5'-TRIPHOSPHATE × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；285 K；15% (w/v) PEG 3350, 0.1 M Bis-Tris propane pH 8.9, 0.2 M sodium citrate tribasic dihydrate	Resolution 2.83 Å R-free 0.260
7ZX1 Crystal structure of Pol theta polymerase domain in complex with compound 22 Deposited 2022-05-19	Different construct Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 6 Protein–DNA Monomer；Protein × 1 PDB declaration: trimeric	Chain FFF 1820–2590（771 aa）	Not recorded	MG MAGNESIUM ION × 1 DG3 2'-3'-DIDEOXYGUANOSINE-5'-TRIPHOSPHATE × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；285 K；15% (w/v) PEG 3350, 0.1 M Bis-Tris propane pH 8.9, 0.2 M sodium citrate tribasic dihydrate	Resolution 2.83 Å R-free 0.260
8E23 Human DNA polymerase theta in complex with allosteric inhibitor Deposited 2022-08-13	Different construct Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: trimeric	Chain A 1818–2590（773 aa）	Not recorded	MG MAGNESIUM ION × 1 DG3 2'-3'-DIDEOXYGUANOSINE-5'-TRIPHOSPHATE × 1 UAF N-methyl-N-phenyl[(3aM)-3-(trifluoromethyl)cyclopenta[c]pyrazol-2(1H)-yl]ethanethioamide × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 7.5；291 K；18.5 % PEG 3350; 0.2M diammonium tartrate	Resolution 2.59 Å R-free 0.295
8E23 Human DNA polymerase theta in complex with allosteric inhibitor Deposited 2022-08-13	Different construct Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 2 Protein–DNA Monomer；Protein × 1 PDB declaration: trimeric	Chain D 1818–2590（773 aa）	Not recorded	MG MAGNESIUM ION × 1 DG3 2'-3'-DIDEOXYGUANOSINE-5'-TRIPHOSPHATE × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 7.5；291 K；18.5 % PEG 3350; 0.2M diammonium tartrate	Resolution 2.59 Å R-free 0.295
8E24 Human DNA polymerase theta in complex with allosteric inhibitor Deposited 2022-08-13	Different construct Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: trimeric	Chain A 1818–2590（773 aa）	Not recorded	MG MAGNESIUM ION × 1 DG3 2'-3'-DIDEOXYGUANOSINE-5'-TRIPHOSPHATE × 1 UA6 2-[2,4-bis(trifluoromethyl)phenyl]-N-phenyl-N-[3-(pyridazin-3-yl)prop-2-yn-1-yl]acetamide × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 7.5；291 K；16% PEG 3350, 0.2M diammonium tartrate, 2% glycerol	Resolution 2.34 Å R-free 0.266
8E24 Human DNA polymerase theta in complex with allosteric inhibitor Deposited 2022-08-13	Different construct Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 2 Protein–DNA Monomer；Protein × 1 PDB declaration: trimeric	Chain D 1818–2590（773 aa）	Not recorded	MG MAGNESIUM ION × 1 DG3 2'-3'-DIDEOXYGUANOSINE-5'-TRIPHOSPHATE × 1 UA6 2-[2,4-bis(trifluoromethyl)phenyl]-N-phenyl-N-[3-(pyridazin-3-yl)prop-2-yn-1-yl]acetamide × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 7.5；291 K；16% PEG 3350, 0.2M diammonium tartrate, 2% glycerol	Resolution 2.34 Å R-free 0.266
8GD7 Loop Deleted DNA Polymerase Theta Polymerase Domain in Complex with Double Strand DNA Overhang and Inhibitor Deposited 2023-03-03	Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: trimeric	Chain A 1819–2590（772 aa）	Not recorded	MG MAGNESIUM ION × 1 DG3 2'-3'-DIDEOXYGUANOSINE-5'-TRIPHOSPHATE × 1 Z5X 2-(3-methyl-2-oxoimidazolidin-1-yl)-4,6-bis(trifluoromethyl)phenyl (4-fluorophenyl)methylcarbamate × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 7.5；291.15 K；0.24 M Sodium citrate, 18% (w/v) PEG 3350, 0.1 M Bis Tris Propane pH 7.5	Resolution 3.24 Å R-free 0.244
8W0A Human DNA polymerase theta helicase domain in complex with ssDNA, dimer form Deposited 2024-02-13	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Homooligomer；Protein × 2 PDB declaration: tetrameric	Chain A 1–894（894 aa） Chain C 1–894（894 aa）	Not recorded	No recorded non-water small molecule	ELECTRON MICROSCOPY cryo-EM buffer pH 8 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.20 Å
9ASJ Human DNA polymerase theta helicase domain in complex with AMP-PNP, dimer form Deposited 2024-02-26	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein homooligomer Homooligomer；Protein × 2 PDB declaration: dimeric	Chain A 1–894（894 aa） Chain B 1–894（894 aa）	Not recorded	ANP PHOSPHOAMINOPHOSPHONIC ACID-ADENYLATE ESTER × 2	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.50 Å
9ASK Human DNA polymerase theta helicase domain dimer, apo-form Deposited 2024-02-26	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein homooligomer Homooligomer；Protein × 2 PDB declaration: dimeric	Chain A 1–894（894 aa） Chain B 1–894（894 aa）	Not recorded	No recorded non-water small molecule	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.60 Å
9ASL Human DNA polymerase theta helicase domain tetramer, apo-form Deposited 2024-02-26	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein homooligomer Homooligomer；Protein × 4 PDB declaration: tetrameric	Chain A 1–894（894 aa） Chain B 1–894（894 aa） Chain C 1–894（894 aa） Chain D 1–894（894 aa）	Not recorded	No recorded non-water small molecule	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.50 Å
9AU5 Ternary complex of human DNA polymerase theta polymerase domain with a cognate C:G base pair Deposited 2024-02-28	Different construct Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: trimeric	Chain A 1792–2590（799 aa）	Not recorded	DGT 2'-DEOXYGUANOSINE-5'-TRIPHOSPHATE × 1 MG MAGNESIUM ION × 1	ELECTRON MICROSCOPY cryo-EM buffer pH 7.6 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.11 Å
9AU8 Ternary complex of human DNA polymerase theta polymerase domain with a mismatched T:T base pair Deposited 2024-02-28	Different construct Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: trimeric	Chain A 1792–2590（799 aa）	Not recorded	TTP THYMIDINE-5'-TRIPHOSPHATE × 1 MG MAGNESIUM ION × 1	ELECTRON MICROSCOPY cryo-EM buffer pH 7.6 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.44 Å
9AU9 Ternary complex of human DNA polymerase theta polymerase domain with a mismatched T:G base pair Deposited 2024-02-28	Different construct Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: trimeric	Chain A 1792–2590（799 aa）	Not recorded	DGT 2'-DEOXYGUANOSINE-5'-TRIPHOSPHATE × 1	ELECTRON MICROSCOPY cryo-EM buffer pH 7.6 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.32 Å
9BH6 Human DNA polymerase theta helicase domain tetramer in the apo form Deposited 2024-04-19	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein homooligomer Homooligomer；Protein × 4 PDB declaration: tetrameric	Chain A 2–894（893 aa） Chain B 2–894（893 aa） Chain C 2–894（893 aa） Chain D 2–894（893 aa）	Not recorded	No recorded non-water small molecule	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE；3 microliters of sample was applied to the surface of the grid, blotted with Whatman 1 filter paper until 2 seconds after the liquid spot on the filter paper stopped spreading, and the grid was plunged into a liquid ethane pool cooled by liquid nitrogen using a manual plunge freezer.	Resolution 3.30 Å
9BH7 Human DNA polymerase theta helicase domain dimer in the apo form Deposited 2024-04-19	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein homooligomer Homooligomer；Protein × 2 PDB declaration: dimeric	Chain A 2–894（893 aa） Chain B 2–894（893 aa）	Not recorded	No recorded non-water small molecule	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE；3 microliters of sample was applied to the surface of the grid, blotted with Whatman 1 filter paper until 2 seconds after the liquid spot on the filter paper stopped spreading, and the grid was plunged into a liquid ethane pool cooled by liquid nitrogen using a manual plunge freezer.	Resolution 3.50 Å
9BH8 Human DNA polymerase theta helicase domain dimer bound to DNA in the microhomology searching conformation Deposited 2024-04-19	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Homooligomer；Protein × 2 PDB declaration: tetrameric	Chain A 2–894（893 aa） Chain B 2–894（893 aa）	Not recorded	No recorded non-water small molecule	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE；3 microliters of sample was applied to the surface of the grid, blotted with Whatman 1 filter paper until 2 seconds after the liquid spot on the filter paper stopped spreading, and the grid was plunged into a liquid ethane bath cooled by liquid nitrogen.	Resolution 3.60 Å
9BH9 Human DNA polymerase theta helicase domain dimer bound to DNA in the microhomology aligning conformation Deposited 2024-04-19	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Homooligomer；Protein × 2 PDB declaration: tetrameric	Chain A 2–894（893 aa） Chain B 2–894（893 aa）	Not recorded	No recorded non-water small molecule	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE；3 microliters of sample was applied to the surface of the grid, blotted for 2 seconds after the liquid spot on the filter paper stopped spreading, and the grid was plunged into a liquid ethane bath cooled by liquid nitrogen.	Resolution 3.50 Å
9BHA Human DNA polymerase theta helicase domain dimer bound to DNA in the microhomology annealed conformation Deposited 2024-04-19	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Homooligomer；Protein × 2 PDB declaration: tetrameric	Chain A 2–894（893 aa） Chain B 2–894（893 aa）	Not recorded	No recorded non-water small molecule	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE；3 microliters of sample was applied to the surface of the grid, blotted with Whatman 1 filter paper until 2 seconds after the liquid spot on the filter paper stopped spreading, and the grid was plunged into a liquid ethane bath cooled by liquid nitrogen.	Resolution 3.50 Å
9BP9 Human DNA polymerase theta helicase domain in complex with inhibitor AB25583, dimer form Deposited 2024-05-07	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein homooligomer Homooligomer；Protein × 2 PDB declaration: dimeric	Chain A 1–894（894 aa） Chain C 1–894（894 aa）	Not recorded	WCN (4P)-N-{5-[(4-chlorophenyl)methoxy]-1,3,4-thiadiazol-2-yl}-4-(2-methoxyphenyl)pyridine-3-carboxamide × 2	ELECTRON MICROSCOPY cryo-EM buffer pH 8 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.21 Å
9BPA Human DNA polymerase theta helicase domain in complex with inhibitor AB25583, tetramer form Deposited 2024-05-07	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein homooligomer Homooligomer；Protein × 4 PDB declaration: tetrameric	Chain A 1–894（894 aa） Chain C 1–894（894 aa） Chain E 1–894（894 aa） Chain G 1–894（894 aa）	Not recorded	WCN (4P)-N-{5-[(4-chlorophenyl)methoxy]-1,3,4-thiadiazol-2-yl}-4-(2-methoxyphenyl)pyridine-3-carboxamide × 4	ELECTRON MICROSCOPY cryo-EM buffer pH 8 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.21 Å
9C5Q Human DNA polymerase theta helicase domain in microhomology annealed state 2, dimer form Deposited 2024-06-06	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Homooligomer；Protein × 2 PDB declaration: tetrameric	Chain A 68–891（824 aa） Chain C 68–891（824 aa）	Not recorded	No recorded non-water small molecule	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.10 Å
9D6N Loop-Deleted DNA Polymerase Theta in Complex with a dsDNA Overhang and an Allostertic Inhibitor Deposited 2024-08-15	Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: trimeric	Chain A 1819–2590（772 aa）	Not recorded	MG MAGNESIUM ION × 1 DG3 2'-3'-DIDEOXYGUANOSINE-5'-TRIPHOSPHATE × 1 A1A2C 2-{3-[(2R)-3-(dimethylamino)-2-hydroxypropyl]-2-oxoimidazolidin-1-yl}-4,6-bis(trifluoromethyl)phenyl (4-fluorophenyl)(methyl)carbamate × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 7.5；277.15 K；0.1M Bis Tris Propane pH 7.5, 16% PEG 3350, 0.23M Sodium Citrate	Resolution 2.43 Å R-free 0.237
9D6N Loop-Deleted DNA Polymerase Theta in Complex with a dsDNA Overhang and an Allostertic Inhibitor Deposited 2024-08-15	Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 2 Protein–DNA Monomer；Protein × 1 PDB declaration: trimeric	Chain B 1819–2590（772 aa）	Not recorded	MG MAGNESIUM ION × 1 DG3 2'-3'-DIDEOXYGUANOSINE-5'-TRIPHOSPHATE × 1 A1A2C 2-{3-[(2R)-3-(dimethylamino)-2-hydroxypropyl]-2-oxoimidazolidin-1-yl}-4,6-bis(trifluoromethyl)phenyl (4-fluorophenyl)(methyl)carbamate × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 7.5；277.15 K；0.1M Bis Tris Propane pH 7.5, 16% PEG 3350, 0.23M Sodium Citrate	Resolution 2.43 Å R-free 0.237
9OSW Tetrameric POLQ Helicase-like Domain Bound to Cmpd 19, a Small-Molecule ATPase Inhibitor and Drug Candidate Analog Deposited 2025-05-26	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein homooligomer Homooligomer；Protein × 4 PDB declaration: tetrameric	Chain A 1–904（904 aa） Fragment：N-terminal domain Chain B 1–904（904 aa） Fragment：N-terminal domain Chain C 1–904（904 aa） Fragment：N-terminal domain Chain D 1–904（904 aa） Fragment：N-terminal domain	Not recorded	A1CER (3M)-2'-chloro-N-{5-[(1S,2S)-2-(4-cyanophenyl)cyclopropyl]-1,3,4-thiadiazol-2-yl}-5'-methoxy[3,4'-bipyridine]-4-carboxamide × 4	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5；20 mM HEPES pH 7.5, 300 mM NaCl, 1 mM TCEP, 5% glycerol cryo-EM vitrification conditions Cryogen ETHANE；3 microL drop of sample suspension is applied to an EM grid that has been plasma-cleaned using a Gatan Solarus. After blotting the sample away with filter paper, grids are plunge-frozen in liquid ethane. Grids are stored under liquid nitrogen until transferred to the transmission electron microscope for imaging.	Resolution 2.67 Å
9OSY Tetrameric POLQ Helicase-like Domain Bound to Cmpd 36, a Small-Molecule ATPase Inhibitor and Drug Candidate Analog Deposited 2025-05-26	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein homooligomer Homooligomer；Protein × 4 PDB declaration: tetrameric	Chain A 1–904（904 aa） Fragment：N-terminal domain Chain B 1–904（904 aa） Fragment：N-terminal domain Chain C 1–904（904 aa） Fragment：N-terminal domain Chain D 1–904（904 aa） Fragment：N-terminal domain	Not recorded	A1CEQ (2P)-N-[5-(cyclopropylethynyl)-1,3,4-thiadiazol-2-yl]-2-[2-(difluoromethyl)-5-methoxypyridin-4-yl]-4-[(4-hydroxyoxan-4-yl)ethynyl]benzamide × 4	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5；20 mM HEPES pH 7.5, 300 mM NaCl, 1 mM TCEP, 5% glycerol cryo-EM vitrification conditions Cryogen ETHANE；3 microL drop of sample suspension is applied to an EM grid that has been plasma-cleaned using a Gatan Solarus. After blotting the sample away with filter paper, grids are plunge-frozen in liquid ethane. Grids are stored under liquid nitrogen until transferred to the transmission electron microscope for imaging.	Resolution 2.90 Å
9YSH Allosteric inhibitor of human DNA polymerase theta Deposited 2025-10-18	Different construct Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: trimeric	Chain A 1818–2590（773 aa）	Not recorded	MG MAGNESIUM ION × 1 DG3 2'-3'-DIDEOXYGUANOSINE-5'-TRIPHOSPHATE × 1 A1CZX N-(4-{2-[2,4-bis(trifluoromethyl)phenyl]-N-phenylacetamido}but-2-yn-1-yl)pyridine-3-carboxamide × 2 GOL GLYCEROL × 2	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；291 K；14% PEG 3350, 200 mM sodium-potassium tartrate, 6% glycerol, 0.02% sucrose monolaurate, and 20 mM spermine tetrahydrochloride	Resolution 2.71 Å R-free 0.251
9YSH Allosteric inhibitor of human DNA polymerase theta Deposited 2025-10-18	Different construct Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 2 Protein–DNA Monomer；Protein × 1 PDB declaration: trimeric	Chain D 1818–2590（773 aa）	Not recorded	MG MAGNESIUM ION × 1 DG3 2'-3'-DIDEOXYGUANOSINE-5'-TRIPHOSPHATE × 1 A1CZX N-(4-{2-[2,4-bis(trifluoromethyl)phenyl]-N-phenylacetamido}but-2-yn-1-yl)pyridine-3-carboxamide × 1 GOL GLYCEROL × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；291 K；14% PEG 3350, 200 mM sodium-potassium tartrate, 6% glycerol, 0.02% sucrose monolaurate, and 20 mM spermine tetrahydrochloride	Resolution 2.71 Å R-free 0.251
9YSI Covalent allosteric inhibitor of human DNA polymerase theta Deposited 2025-10-18	Different construct Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: trimeric	Chain A 1818–2590（773 aa）	Not recorded	MG MAGNESIUM ION × 2 DG3 2'-3'-DIDEOXYGUANOSINE-5'-TRIPHOSPHATE × 1 CL CHLORIDE ION × 3 GOL GLYCEROL × 3 A1CZ4 N-(4-{2-[2,4-bis(trifluoromethyl)phenyl]-N-phenylacetamido}but-2-yn-1-yl)-2-(ethanesulfonamido)benzamide × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；291 K；22% PEG 3350, 200 mM sodium-potassium tartrate, 3% glycerol, 0.02% sucrose monolaurate, and 20 mM spermine tetrahydrochloride	Resolution 2.00 Å R-free 0.211
9YSI Covalent allosteric inhibitor of human DNA polymerase theta Deposited 2025-10-18	Different construct Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 2 Protein–DNA Monomer；Protein × 1 PDB declaration: trimeric	Chain D 1818–2590（773 aa）	Not recorded	MG MAGNESIUM ION × 1 DG3 2'-3'-DIDEOXYGUANOSINE-5'-TRIPHOSPHATE × 1 GOL GLYCEROL × 2 A1CZ4 N-(4-{2-[2,4-bis(trifluoromethyl)phenyl]-N-phenylacetamido}but-2-yn-1-yl)-2-(ethanesulfonamido)benzamide × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；291 K；22% PEG 3350, 200 mM sodium-potassium tartrate, 3% glycerol, 0.02% sucrose monolaurate, and 20 mM spermine tetrahydrochloride	Resolution 2.00 Å R-free 0.211

32 other PDB entries and 57 assemblies. Open the comparison page and filter oligomeric states

View Construct and Data Evidence

UniProt name	DPOLQ_HUMAN
Isoform	—
PDB entities	1
Chains and sequence ranges	Author chain A； PDBConstruct 1–652； UniProt 1819–2590

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

SAXS scattering curve SAXS Profile

P(r) Distance Distribution P(r) Distribution

Download Download SAXS (.dat) P(r) (.pr.out) CIF

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	9d6o
Deposition date deposition_date	2024-08-15
Structure title title	Loop-Deleted DNA Polymerase Theta Polymerase Domain in Complex with a dsDNA Overhang and an Allosteric Inhibitor
Keywords keywords	DNA Polymerase Theta, DNA Polymerase, Allosteric Inhibitor, Protein-DNA Complex, DNA BINDING PROTEIN; DNA BINDING PROTEIN
Experimental Method method	X-RAY DIFFRACTION

▼

3. SAXS Parameters (CRYSOL theoretical calculation) 3. SAXS Parameters (CRYSOL)

Radius of gyration Rg (Guinier) rg_guinier	27.74 Å
Radius of gyration Rg (electron density) rg_electron	27.28 Å
Forward intensity I(0) i0	204234000.00
Molecular weight molecular_weight	73249.0 kDa
Excluded volume excluded_volume	69351 Å³
Envelope volume envelope_volume	121520 Å³
Hydration-shell volume shell_volume	36605 Å³
Envelope diameter envelope_diameter	97.4 Å
Shell Rg shell_rg	35.08 Å
Envelope Rg envelope_rg	27.34 Å
Shape Rg shape_rg	27.31 Å
Total Rg total_rg	27.79 Å
Total atoms total_atoms	5489
Residues n_residues	650
Spherical-harmonic order n_harmonics	20
q range q_range	— – 0.5000 Å⁻¹
Data points n_points	101
Shell type shell_type	directional
Solvent electron density solvent_density	0.3340 e/Å³
Shell contrast contrast_shell	0.0300 e/Å³
CRYSOL version crysol_version	4.1.3

▼

4. P(r) Distance Distribution (GNOM inversion) 4. P(r) Analysis (GNOM)

Maximum dimension Dmax dmax	91.8 Å
Rg (real space) rg_real	27.68 Å
Rg uncertainty (real space) rg_real_error	0.56 Å
I(0) (real space) i0_real	2.0420e+08
I(0) uncertainty (real space) i0_real_error	2.8480e+06
Rg (reciprocal space) rg_reciprocal	27.70 Å
I(0) (reciprocal space) i0_reciprocal	204200000.0000
Solution quality estimate total_estimate	0.8824
Solution quality rating solution_quality	GOOD a GOOD solution
P(r) peaks n_peaks	2
Primary peak position r_peak_primary	32.2 Å
Skewness Skewness skewness	0.336
Kurtosis Kurtosis kurtosis	-0.239
Angular range angular_range	— – 0.2850 Å⁻¹
Current regularization parameter α current_alpha	0.0000
Highest regularization parameter α highest_alpha	25620000.0000
Real-space data points n_real_points	58
GNOM version gnom_version	4.1.3
Quality Criteria quality_criteria	AN1: 0.000; Oscil: 0.836; Stabil: 1.000; Sysdev: 1.000; Positv: 1.000; Valcen: 1.000; Smooth: 0.958

▶

5. Crystallography and Experiment 5. Crystallography & Experiment

▶

6. Entities and Polymers Entities & Polymers (6)

Entity 1 Entity 1 polymer

Description description	DNA polymerase theta
Molecular weight formula_weight	72589.8 kDa
EC 编号 ec_number	3.6.4.12,2.7.7.7,2.7.7.49
Source method src_method	man
Copy count entity_count	1

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A
Atom count atom_count	5489

SSSSESLSIIDVASDQNLFQTFIKEWRCKKRFSISLACEKIRGSGDDTLVVGLAVCWGGRDAYYFSLGGSGGLDPSLTLKDRMWYLQSCLRKESDKECSVVIYDFIQSYKILLLSCGISLEQSYEDPKVACWLLDPDSQEPTLHSIVTSFLPHELPLLEGMETSQGIQSLGLNAGSEHSGRYRASVESILIFNSMNQLNSLLQKENLQDVFRKVEMPSQYCLALLELNGIGFSTAECESQKHIMQAKLDAIETQAYQLAGHSFSFTSSDDIAEVLFLELKLPPGGSGGQFSTSKDVLNKLKALHPLPGLILEWRRITNAITKVVFPLQREKCLNPFLGMERIYPVSQSHTATGRITFTEPNIQNVPRDFEIKMGGSGGMPFSISMRHAFVPFPGGSILAADYSQLELRILAHLSHDRRLIQVLNTGADVFRSIAAEWKMIEPESVGDDLRQQAKQICYGIIYGMGAKSLGEQMGIKENDAACYIDSFKSRYTGINQFMTETVKNCKRDGFVQTILGRRRYLPGIKDNNPYRKAHAERQAINTIVQGSAADIVKIATVNIQKQLETFHSTFKSHGHREGMLQSDGGSGGCPIRGGFFILQLHDELLYEVAEEDVVQVAQIVKNEMESAVKLSVKLKVKVKIGASWGELKDFDV

来源 Source

来源生物 organism	Homo sapiens
通用名 common_name	human
NCBI Class编号 ncbi_taxonomy_id	9606
宿主生物 host_organism	Escherichia coli

Entity 2 Entity 2 polymer

Description description	DNA Template
Molecular weight formula_weight	7372.7 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	E

GCGAGACTCCGCGCTGCGACGTCG

Entity 3 Entity 3 polymer

Description description	DNA Primer
Molecular weight formula_weight	4266.8 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	F

CGACGTCGCAGCGC

Entity 4 Entity 4 non-polymer

Description description	MAGNESIUM ION
Molecular weight formula_weight	24.3 kDa
Source method src_method	syn
Copy count entity_count	1

Entity 5 Entity 5 non-polymer

Description description	2'-3'-DIDEOXYGUANOSINE-5'-TRIPHOSPHATE
Molecular weight formula_weight	491.2 kDa
Source method src_method	syn
Copy count entity_count	1

Entity 6 Entity 6 non-polymer

Description description	2-[3-(2-hydroxyethyl)-2-oxoimidazolidin-1-yl]-4,6-bis(trifluoromethyl)phenyl (4-fluorophenyl)(methyl)carbamate
Molecular weight formula_weight	509.4 kDa
Source method src_method	syn
Copy count entity_count	1

▶

8. Citations (1)

▶

Unit-cell length a length_a	172.356 Å
Unit-cell length b length_b	172.356 Å
Unit-cell length c length_c	62.415 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	90.00 °
Unit-cell angle γ angle_gamma	120.00 °
Molecules per unit cell Z z_pdb	6

Space group space_group	P 31 2 1
Space-group number int_tables_number	152
Crystal system crystal_system	trigonal

Resolution resolution	3.310 Å
Low-resolution limit resolution_low	149.260 Å
R factor r_factor	0.2090
R_work r_work	0.2090
R_free r_free	0.2335

fit	/app/data/saxs_computation/d6/9d6o/9d6o.fit
pddf	/app/data/pr_computation/d6/9d6o/9d6o.pr.out
profile	/app/data/saxs_computation/d6/9d6o/9d6o.dat

Loop-Deleted DNA Polymerase Theta Polymerase Domain in Complex with a dsDNA Overhang and an Allosteric Inhibitor

1. Protein Identity and Related Structures Protein Identity & Related Structures

DNA polymerase theta

State in the Current Structure

Other States of the Same Protein in the Database

SAXS scattering curve SAXS Profile

P(r) Distance Distribution P(r) Distribution

2. Structure Basics 2. Structure Basics

3. SAXS Parameters (CRYSOL theoretical calculation) 3. SAXS Parameters (CRYSOL)

4. P(r) Distance Distribution (GNOM inversion) 4. P(r) Analysis (GNOM)

5. Crystallography and Experiment 5. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

6. Entities and Polymers Entities & Polymers (6)

Entity 1 Entity 1 polymer

Polymer Polymer

来源 Source

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 polymer

Polymer Polymer

Entity 4 Entity 4 non-polymer

Entity 5 Entity 5 non-polymer

Entity 6 Entity 6 non-polymer

8. Citations (1)

9. Files and Curves (10)

Files (7)

Curves (3)