SAXSdb — 9lm3

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

Retron Ec67 protein

Escherichia coli

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Other combination	Homooligomer	Protein 3 DNA 6 RNA 6	DNA (67-MER) × 3 RNA (62-MER) × 3 ;RNA (5'-R(GPUPGPCPCPUPGPCPAPUPGPCPGPU)-3') ; × 3 ;DNA (5'-D(PGPGP*A)-3') ; × 3	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	RT67_ECOLX
Isoform	—
PDB entities	1
Chains and sequence ranges	Author chain A； PDBConstruct 1–586； UniProt 1–586 Author chain E； PDBConstruct 1–586； UniProt 1–586 Author chain I； PDBConstruct 1–586； UniProt 1–586

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	9lm3
Deposition date deposition_date	2025-01-18
Last revision last_revision	2025-09-17
Structure title title	cryo-EM structure of retron Eco2
Keywords keywords	RNA-mediated retron Eco2 oligomerization, RNA BINDING PROTEIN/DNA/RNA, RNA BINDING PROTEIN-DNA-RNA complex; RNA BINDING PROTEIN/DNA/RNA
Experimental Method method	ELECTRON MICROSCOPY

▼

3. Official assembly/model SAXS Official SAXS Profiles

This page reads only the latest assembly calculations. Every curve maps to an explicit PDB entry, official biological assembly and coordinate model.

9lm3__assembly_1__model_1

Assembly 1 · Model 1 · CRYSOL 4.1.3-1-20251215 (887e7ef)

Download this curve (.dat)

9lm3__assembly_1__model_1 | I(q)

100 plotted points; both axes use logarithmic scales.

9lm3__assembly_1__model_1 | P(r) · Pending

P(r) will be calculated and displayed separately for the same assembly/model.

Rg（Guinier）	45.89 Å
Rg (electron density)	46.01 Å
Total Rg	46.25 Å
Atom count	35595
Residues	1971
Excluded volume	321320 Å³
Maximum q	0.500 Å⁻¹

Assembly	Model	Structure unit	Oligomeric description	Status	CRYSOL	Actions
1	1	`9lm3__assembly_1__model_1`	pentadecameric （15）	Success	4.1.3-1-20251215 (887e7ef)	View Download

▶

4. Crystallography and Experiment 4. Crystallography & Experiment

▶

5. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Description description	Retron Ec67 protein
Molecular weight formula_weight	68673.1 kDa
EC 编号 ec_number	2.7.7.49,3.1.26.4
Source method src_method	man
Copy count entity_count	3

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A,E,I
Atom count atom_count	35595

MTKTSKLDALRAATSREDLAKILDVKLVFLTNVLYRIGSDNQYTQFTIPKKGKGVRTISAPTDRLKDIQRRICDLLSDCRDEIFAIRKISNNYSFGFERGKSIILNAYKHRGKQIILNIDLKDFFESFNFGRVRGYFLSNQDFLLNPVVATTLAKAACYNGTLPQGSPCSPIISNLICNIMDMRLAKLAKKYGCTYSRYADDITISTNKNTFPLEMATVQPEGVVLGKVLVKEIENSGFEINDSKTRLTYKTSRQEVTGLTVNRIVNIDRCYYKKTRALAHALYRTGEYKVPDENGVLVSGGLDKLEGMFGFIDQVDKFNNIKKKLNKQPDRYVLTNATLHGFKLKLNAREKAYSKFIYYKFFHGNTCPTIITEGKTDRIYLKAALHSLETSYPELFREKTDSKKKEINLNIFKSNEKTKYFLDLSGGTADLKKFVERYKNNYASYYGSVPKQPVIMVLDNDTGPSDLLNFLRNKVKSCPDDVTEMRKMKYIHVFYNLYIVLTPLSPSGEQTSMEDLFPKDILDIKIDGKKFNKNNDGDSKTEYGKHIFSMRVVRDKKRKIDFKAFCCIFDAIKDIKEHYKLMLNSLEHHHHHHHH

Source Source

Source organism organism	Escherichia coli
NCBI taxonomy ID ncbi_taxonomy_id	562
Host organism host_organism	Escherichia coli BL21(DE3)

Entity 2 Entity 2 polymer

Description description	DNA (67-MER)
Molecular weight formula_weight	20522.1 kDa
Source method src_method	man
Copy count entity_count	3

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	B,F,J

TCCTTCGCACAGCACACCTGCCGTATAGCTCTGAATCAAGGATTTTAGGGAGGCGATTCCTCCTGCC

Source Source

Source organism organism	Escherichia coli
NCBI taxonomy ID ncbi_taxonomy_id	562
Host organism host_organism	Escherichia coli BL21(DE3)

Entity 3 Entity 3 polymer

Description description	RNA (62-MER)
Molecular weight formula_weight	20075.9 kDa
Source method src_method	man
Copy count entity_count	3

Polymer Polymer

Polymer type type	polyribonucleotide
Chain IDs strand_id	C,G,K

CACGCAUGUAGGCAGAUUUGUUGGUUGUGAAUCGCAACCAGUGGCCUUAAUGGCAGGAGGAA

Source Source

Source organism organism	Escherichia coli
NCBI taxonomy ID ncbi_taxonomy_id	562
Host organism host_organism	Escherichia coli BL21(DE3)

Entity 4 Entity 4 polymer

Description description	;RNA (5'-R(GPUPGPCPCPUPGPCPAPUPGPCPGPU)-3') ;
Molecular weight formula_weight	4455.7 kDa
Source method src_method	man
Copy count entity_count	3

Polymer Polymer

Polymer type type	polyribonucleotide
Chain IDs strand_id	D,H,L

GUGCCUGCAUGCGU

Source Source

Source organism organism	Escherichia coli
NCBI taxonomy ID ncbi_taxonomy_id	562
Host organism host_organism	Escherichia coli BL21(DE3)

Entity 5 Entity 5 polymer

Description description	;DNA (5'-D(PGPGP*A)-3') ;
Molecular weight formula_weight	926.7 kDa
Source method src_method	man
Copy count entity_count	3

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	M,N,O

GGA

Source Source

Source organism organism	Escherichia coli
NCBI taxonomy ID ncbi_taxonomy_id	562
Host organism host_organism	Escherichia coli BL21(DE3)

▶

Unit-cell length a length_a	1.000 Å
Unit-cell length b length_b	1.000 Å
Unit-cell length c length_c	1.000 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	90.00 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	—

Space group space_group	P 1
Space-group number int_tables_number	1
Crystal system crystal_system	—

Resolution resolution	2.600 Å
Low-resolution limit resolution_low	— Å
R factor r_factor	—
R_work r_work	—
R_free r_free	—

Resolution resolution	2.60 Å
Resolution测定Method resolution_method	—
颗粒数 num_particles	574158

cryo-EM structure of retron Eco2

1. Protein Identity and Related Structures Protein Identity & Related Structures

Retron Ec67 protein

State in the Current Structure

Other States of the Same Protein in the Database

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

9lm3__assembly_1__model_1

9lm3__assembly_1__model_1 | I(q)

9lm3__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

冷冻电镜 EM 3D

5. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Source Source

Entity 3 Entity 3 polymer

Polymer Polymer

Source Source

Entity 4 Entity 4 polymer

Polymer Polymer

Source Source

Entity 5 Entity 5 polymer

Polymer Polymer

Source Source

7. Citations (1)

cryo-EM structure of retron Eco2

1. Protein Identity and Related Structures Protein Identity & Related Structures

Retron Ec67 protein

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

9lm3__assembly_1__model_1

9lm3__assembly_1__model_1 | I(q)

9lm3__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

冷冻电镜 EM 3D

5. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Source Source

Entity 3 Entity 3 polymer

Polymer Polymer

Source Source

Entity 4 Entity 4 polymer

Polymer Polymer

Source Source

Entity 5 Entity 5 polymer

Polymer Polymer

Source Source

7. Citations (1)