9qcc

Activated XauSPARDA filament assembly with bound dsDNA substrate

Method: ELECTRON MICROSCOPY

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

DUF4365 domain-containing protein

Xanthobacter autotrophicus Py2

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Other combination	Heteromer	Protein 16 DNA 10 RNA 8	Protein argonaute × 8 （A7ICE9） ;DNA (5'-D(APTPTPCPGPGPCPCPGPTPGPTPAPCPAPAPT)-3') ; × 8 ;RNA (5'-R(PAPUPUPGPUPAPCPAPCPGPGPCPCPGPAPAPU)-3') ; × 8 dsDNA substrate, first strand × 1 dsDNA substrate, second strand × 1 CALCIUM ION × 12	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	A7ICE8_XANP2
Isoform	—
PDB entities	1
Chains and sequence ranges	Author chain A； PDBConstruct 15–458； UniProt 1–444 Author chain E； PDBConstruct 15–458； UniProt 1–444 Author chain I； PDBConstruct 15–458； UniProt 1–444 Author chain M； PDBConstruct 15–458； UniProt 1–444 Author chain Q； PDBConstruct 15–458； UniProt 1–444 Author chain U； PDBConstruct 15–458； UniProt 1–444 Author chain W； PDBConstruct 15–458； UniProt 1–444 Author chain Y； PDBConstruct 15–458； UniProt 1–444

Protein argonaute

Xanthobacter autotrophicus Py2

UniProt A7ICE9

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Other combination	Heteromer	Protein 16 DNA 10 RNA 8	DUF4365 domain-containing protein × 8 （A7ICE8） ;DNA (5'-D(APTPTPCPGPGPCPCPGPTPGPTPAPCPAPAPT)-3') ; × 8 ;RNA (5'-R(PAPUPUPGPUPAPCPAPCPGPGPCPCPGPAPAPU)-3') ; × 8 dsDNA substrate, first strand × 1 dsDNA substrate, second strand × 1 CALCIUM ION × 12	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	A7ICE9_XANP2
Isoform	—
PDB entities	2
Chains and sequence ranges	Author chain B； PDBConstruct 1–482； UniProt 1–482 Author chain F； PDBConstruct 1–482； UniProt 1–482 Author chain J； PDBConstruct 1–482； UniProt 1–482 Author chain N； PDBConstruct 1–482； UniProt 1–482 Author chain R； PDBConstruct 1–482； UniProt 1–482 Author chain V； PDBConstruct 1–482； UniProt 1–482 Author chain X； PDBConstruct 1–482； UniProt 1–482 Author chain Z； PDBConstruct 1–482； UniProt 1–482

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	9qcc
Deposition date deposition_date	2025-03-04
Structure title title	Activated XauSPARDA filament assembly with bound dsDNA substrate
Keywords keywords	short prokaryotic Argonaute, bacterial defence system, DREN domain, DREN-APAZ, RNA BINDING PROTEIN; RNA BINDING PROTEIN
Experimental Method method	ELECTRON MICROSCOPY

▼

3. Official assembly/model SAXS Official SAXS Profiles

This page reads only the latest assembly calculations. Every curve maps to an explicit PDB entry, official biological assembly and coordinate model.

9qcc__assembly_1__model_1

Assembly 1 · Model 1 · CRYSOL 4.1.3-1-20251215 (887e7ef)

Download this curve (.dat)

9qcc__assembly_1__model_1 | I(q)

100 plotted points; both axes use logarithmic scales.

9qcc__assembly_1__model_1 | P(r) · Pending

P(r) will be calculated and displayed separately for the same assembly/model.

Rg（Guinier）	74.06 Å
Rg (electron density)	74.12 Å
Total Rg	74.05 Å
Atom count	60098
Residues	7020
Excluded volume	1045600 Å³
Maximum q	0.500 Å⁻¹

Assembly	Model	Structure unit	Oligomeric description	Status	CRYSOL	Actions
1	1	`9qcc__assembly_1__model_1`	34-meric （34）	Success	4.1.3-1-20251215 (887e7ef)	View Download

▶

4. Crystallography and Experiment 4. Crystallography & Experiment

▶

5. Entities and Polymers Entities & Polymers (7)

Entity 1 Entity 1 polymer

Description description	DUF4365 domain-containing protein
Molecular weight formula_weight	52420.3 kDa
Source method src_method	man
Copy count entity_count	8

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A,E,I,M,Q,U,W,Y
Atom count atom_count	60115

MGGSHHHHHHGMASMSKRITDSQVLGELGETAIKKIVLETGFLYEQRGRLEAGTDGIIELRDPKSGAPLGKLLGVQVKSTESGQYVRENDNSFEYLLKPDDLKYWRTSNIPVIIVLWRKSDETAYWKDVSDCVRGEERRLKFDKGTDVFDPRSADRIGALTIDRRTPGVFLPPLNKGEDAIINLLRIRLPDEIFISTSPFGSGRDAVPELVKHGNVRFDWVIRKRRFVSFFDPREYGTRAIVDLDQVEAVDTKLIAFNDEQDDLNDTMDLLRRTVERQTATQLSFLRKDRLFHFKAVGVGKSRSYRYMSNVNETSAKVVSAYSSKKKDGWGYVRHHAARLRFERLADEWFLVIDPDFHFTTDGFQPHRYPEALLAGKKRLERNAAVRGQVTMWQHLLVESGKHEVGLFDADKPAPLLQFERLPVIQLSQAVPESSWNRTDPRAKEMEAQDLFEEGGVG

Source Source

Source organism organism	Xanthobacter autotrophicus Py2
NCBI taxonomy ID ncbi_taxonomy_id	78245
Host organism host_organism	Escherichia coli

Entity 2 Entity 2 polymer

Description description	Protein argonaute
Molecular weight formula_weight	53589.7 kDa
Source method src_method	man
Copy count entity_count	8

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	B,F,J,N,R,V,X,Z

MTFKAHVFDEPMLEFGDGGQHCDPRQGLREHGPLQPRSGDVIRVGVIGTDDTVAGFTEFLAETGRGIESGNKQLINLNPDFPGLGNQNPFRCKFEVPDGATVTISRRQVNDITGIGRHDEAVRHAVELISSQLSALVEGSAKPDVIVLALPIPLIEKLVNAKSEGEDSDDDVDGGDMLNFRDLLKAKTLHLPVPTQIVWPDTWDDAAKIPRKIKRDSNRQTQVKATRAWNLLNALFYKAGKVPWRLLPDQAEYRTSFLGIGFYRDLDGQQLWTSTAQMFDERGRGLILRGARAQTETRGRHPYLTAKDAEDLVVQSIAAYKAHHRHVPARLVVLKTSRFRSEEAEGIDAALGKSGIEMSDLVWVQESSPIAIFRDGNYPVLRGTFVDLDGKGLLYTRGSVPFYGTFPGLRVPRPLLLVPHENSDSTILTLAKDVLALTKVNWNTTQFDQKLPAPIKAAREVGRILKHVEFGTAVSSDFRRYT

Source Source

Source organism organism	Xanthobacter autotrophicus Py2
NCBI taxonomy ID ncbi_taxonomy_id	78245
Host organism host_organism	Escherichia coli BL21(DE3)

Entity 3 Entity 3 polymer

Description description	;DNA (5'-D(APTPTPCPGPGPCPCPGPTPGPTPAPCPAPAP*T)-3') ;
Molecular weight formula_weight	5202.4 kDa
Source method src_method	syn
Copy count entity_count	8

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	C,G,K,O,1,3,5,7

ATTCGGCCGTGTACAAT

Entity 4 Entity 4 polymer

Description description	;RNA (5'-R(PAPUPUPGPUPAPCPAPCPGPGPCPCPGPAPAP*U)-3') ;
Molecular weight formula_weight	5427.3 kDa
Source method src_method	syn
Copy count entity_count	8

Polymer Polymer

Polymer type type	polyribonucleotide
Chain IDs strand_id	D,H,L,P,2,4,6,8

AUUGUACACGGCCGAAU

Entity 5 Entity 5 polymer

Description description	dsDNA substrate, first strand
Molecular weight formula_weight	12994.3 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	S

ATAATGGTTTCTTAGACGTCGTTTTAGAGCTGTGTTGTTTCG

Entity 6 Entity 6 polymer

Description description	dsDNA substrate, second strand
Molecular weight formula_weight	12862.3 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	T

CGAAACAACACAGCTCTAAAACGACGTCTAAGAAACCATTAT

Entity 7 Entity 7 non-polymer

Description description	CALCIUM ION
Molecular weight formula_weight	40.1 kDa
Source method src_method	syn
Copy count entity_count	12

▶

Unit-cell length a length_a	1.000 Å
Unit-cell length b length_b	1.000 Å
Unit-cell length c length_c	1.000 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	90.00 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	—

Space group space_group	P 1
Space-group number int_tables_number	1
Crystal system crystal_system	—

Resolution resolution	3.00 Å
Resolution测定Method resolution_method	—
颗粒数 num_particles	204199

Activated XauSPARDA filament assembly with bound dsDNA substrate

1. Protein Identity and Related Structures Protein Identity & Related Structures

DUF4365 domain-containing protein

State in the Current Structure

Other States of the Same Protein in the Database

Protein argonaute

State in the Current Structure

Other States of the Same Protein in the Database

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

9qcc__assembly_1__model_1

9qcc__assembly_1__model_1 | I(q)

9qcc__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

冷冻电镜 EM 3D

5. Entities and Polymers Entities & Polymers (7)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Source Source

Entity 3 Entity 3 polymer

Polymer Polymer

Entity 4 Entity 4 polymer

Polymer Polymer

Entity 5 Entity 5 polymer

Polymer Polymer

Entity 6 Entity 6 polymer

Polymer Polymer

Entity 7 Entity 7 non-polymer

7. Citations (1)

Activated XauSPARDA filament assembly with bound dsDNA substrate

1. Protein Identity and Related Structures Protein Identity & Related Structures

DUF4365 domain-containing protein

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

Protein argonaute

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

9qcc__assembly_1__model_1

9qcc__assembly_1__model_1 | I(q)

9qcc__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

冷冻电镜 EM 3D

5. Entities and Polymers Entities & Polymers (7)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Source Source

Entity 3 Entity 3 polymer

Polymer Polymer

Entity 4 Entity 4 polymer

Polymer Polymer

Entity 5 Entity 5 polymer

Polymer Polymer

Entity 6 Entity 6 polymer

Polymer Polymer

Entity 7 Entity 7 non-polymer

7. Citations (1)