← Back to search

9qrp

Thermus thermophilus seryl-tRNA synthetase bound to tRNA(ser)(GGA) and seryl-adenylate analogue.

Method: X-RAY DIFFRACTION D_max: 113.9 Å Quality: GOOD

SAXS Profile

P(r) Distribution

▼

1. Structure Basics

entry_id	9qrp
deposition_date	2025-04-04
title	Thermus thermophilus seryl-tRNA synthetase bound to tRNA(ser)(GGA) and seryl-adenylate analogue.
keywords	protein synthesis, aminoacyl-tRNA synthetase, tRNA, RNA BINDING PROTEIN; RNA BINDING PROTEIN
method	X-RAY DIFFRACTION

▼

Download Data

SAXS curve (.dat) P(r) distribution (.pr.out) Structure (CIF)

▼

2. SAXS Parameters (CRYSOL)

rg_guinier	33.67 Å
rg_electron	32.98 Å
i0	328050000.00
molecular_weight	122600.0 kDa
excluded_volume	143200 Å³
envelope_volume	194110 Å³
shell_volume	48377 Å³
envelope_diameter	123.9 Å
shell_rg	40.15 Å
envelope_rg	33.45 Å
shape_rg	32.75 Å
total_rg	34.03 Å
total_atoms	15975
n_residues	900
n_harmonics	20
q_range	— – 0.5000 Å⁻¹
n_points	101
shell_type	directional
solvent_density	0.3340 e/Å³
contrast_shell	0.0300 e/Å³
crysol_version	4.1.3

▼

3. P(r) Analysis (GNOM)

dmax	113.9 Å
rg_real	33.64 Å
rg_real_error	0.87 Å
i0_real	3.2800e+08
i0_real_error	5.6660e+06
rg_reciprocal	33.66 Å
i0_reciprocal	328100000.0000
total_estimate	0.8828
solution_quality	GOOD a GOOD solution
n_peaks	2
r_peak_primary	38.8 Å
skewness	0.321
kurtosis	-0.336
angular_range	— – 0.2350 Å⁻¹
current_alpha	0.0000
highest_alpha	28770000.0000
n_real_points	48
gnom_version	4.1.3
quality_criteria	AN1: 0.000; Oscil: 0.843; Stabil: 1.000; Sysdev: 1.000; Positv: 1.000; Valcen: 0.983; Smooth: 0.960

▶

4. Crystallography & Experiment

▶

5. Entities & Polymer Info (6)

Entity 1 polymer

description	Serine--tRNA ligase
formula_weight	47878.8 kDa
ec_number	6.1.1.11
src_method	man
entity_count	2

Polymer

type	polypeptide(L)
strand_id	A,B
atom_count	16417

MVDLKRLRQEPEVFHRAIREKGVALDLEALLALDREVQELKKRLQEVQTERNQVAKRVPKAPPEEKEALIARGKALGEEAKRLEEALREKEARLEALLLQVPLPPWPGAPVGGEEANREIKRVGGPPEFSFPPLDHVALMEKNGWWEPRISQVSGSRSYALKGDLALYELALLRFAMDFMARRGFLPMTLPSYAREKAFLGTGHFPAYRDQVWAIAETDLYLTGTAEVVLNALHSGEILPYEALPLRYAGYAPAFRSEAGSFGKDVRGLMRVHQFHKVEQYVLTEASLEASDRAFQELLENAEEILRLLELPYRLVEVATGDMGPGKWRQVDIEVYLPSEGRYRETHSCSALLDWQARRANLRYRDPEGRVRYAYTLNNTALATPRILAMLLENHQLQDGRVRVPQALIPYMGKEVLEPCG

Source

organism	Thermus thermophilus HB8
ncbi_taxonomy_id	300852
host_organism	Escherichia coli

Entity 2 polymer

description	tRNA(Ser), GGA anticodon
formula_weight	30401.2 kDa
src_method	nat
entity_count	1

Polymer

type	polyribonucleotide
strand_id	T

GGAGAGGUGCCCGAGUGGCUGAAGGGACACGACUGGAAAUCGUGUAGGGGGGCUUAAACCUCCCUCGCGGGUUCGAAUCCCGCCCUCUCCGCCA

Entity 3 non-polymer

description	5'-O-(N-(L-SERYL)-SULFAMOYL)ADENOSINE
formula_weight	433.4 kDa
src_method	syn
entity_count	2

Entity 4 non-polymer

description	SULFATE ION
formula_weight	96.1 kDa
src_method	syn
entity_count	10

Entity 5 non-polymer

description	MANGANESE (II) ION
formula_weight	54.9 kDa
src_method	syn
entity_count	1

Entity 6 water

description	water
formula_weight	18.0 kDa
src_method	nat
entity_count	214

▶

6. Citations (2)

▶

length_a	121.040 Å
length_b	125.810 Å
length_c	117.620 Å
angle_alpha	90.00 °
angle_beta	90.00 °
angle_gamma	90.00 °
z_pdb	8

space_group	P 21 21 21
int_tables_number	19
crystal_system	orthorhombic

resolution	2.700 Å
resolution_low	19.990 Å
r_factor	0.1866
r_work	0.1842
r_free	0.2296

fit	/app/data/saxs_computation/qr/9qrp/9qrp.fit
pddf	/app/data/pr_computation/qr/9qrp/9qrp.pr.out
profile	/app/data/saxs_computation/qr/9qrp/9qrp.dat

Thermus thermophilus seryl-tRNA synthetase bound to tRNA(ser)(GGA) and seryl-adenylate analogue.

SAXS Profile

P(r) Distribution

1. Structure Basics

Download Data

2. SAXS Parameters (CRYSOL)

3. P(r) Analysis (GNOM)

4. Crystallography & Experiment

Unit Cell

Symmetry

Refinement

Diffraction

5. Entities & Polymer Info (6)

Entity 1 polymer

Polymer

Source

Entity 2 polymer

Polymer

Entity 3 non-polymer

Entity 4 non-polymer

Entity 5 non-polymer

Entity 6 water

6. Citations (2)

7. Files & Curves (10)

Files (7)

Curves (3)