SAXSdb — 9qu8

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

Plastid replication-repair enzyme

Plasmodium falciparum

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–DNA	Monomer	Protein 1 DNA 2	DNA primer strand × 1 DNA template strand × 1 2'-DEOXYGUANOSINE-5'-TRIPHOSPHATE × 1	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	A0A024WKD7_PLAFA
Isoform	—
PDB entities	1
Chains and sequence ranges	Author chain A； PDBConstruct 22–649； UniProt 1414–2041

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	9qu8
Deposition date deposition_date	2025-04-10
Last revision last_revision	2025-10-29
Structure title title	apPol-DNA-nucleotide complex (ternary2)
Keywords keywords	DNA polymerase, REPLICATION; REPLICATION
Experimental Method method	ELECTRON MICROSCOPY

▼

3. Official assembly/model SAXS Official SAXS Profiles

This page reads only the latest assembly calculations. Every curve maps to an explicit PDB entry, official biological assembly and coordinate model.

9qu8__assembly_1__model_1

Assembly 1 · Model 1 · CRYSOL 4.1.3-1-20251215 (887e7ef)

Download this curve (.dat)

9qu8__assembly_1__model_1 | I(q)

100 plotted points; both axes use logarithmic scales.

9qu8__assembly_1__model_1 | P(r) · Pending

P(r) will be calculated and displayed separately for the same assembly/model.

Rg（Guinier）	32.23 Å
Rg (electron density)	31.20 Å
Total Rg	31.83 Å
Atom count	6031
Residues	666
Excluded volume	105650 Å³
Maximum q	0.500 Å⁻¹

Assembly	Model	Structure unit	Oligomeric description	Status	CRYSOL	Actions
1	1	`9qu8__assembly_1__model_1`	trimeric （3）	Success	4.1.3-1-20251215 (887e7ef)	View Download

▶

4. Crystallography and Experiment 4. Crystallography & Experiment

▶

5. Entities and Polymers Entities & Polymers (4)

Entity 1 Entity 1 polymer

Description description	Plastid replication-repair enzyme
Molecular weight formula_weight	76473.5 kDa
Source method src_method	man
Copy count entity_count	1

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A
Atom count atom_count	6031

MGSSHHHHHHSQDPENLYFQGDEITKKYIKDNIINVDDNIIKKKDIFKLKNENNEITECAFEYFESKKKFDDDIESRFFIINDNNYNENINLIYKDIKYCGLNIQTTGLEVFDENIRLIQIAVENYPVIIYDMFNINKKDILDGLRKVLENKNIIKIIQNGKFDAKFLLHNNFKIENIFDTYIASKLLDKNKNMYGFKLNNIVEKYLNVILDKQQQNSVWNNSLLNNNQLFYAARDSSCLLKLYKKLKEEIKKENLHIVNDIENKCILPICDMELNGIKVDLENLQKSTNEILNELNIEKDNLKKKLKDENINVNSQQQVLKALQKNNVRDISNKLIENTSDSNLKNFLNHEEIISLRNYRRLYKLYSAFYLKLPLHINTKTNKIHTTFNQLKTFSGRFSSEKPNLQQIPRQKNIREIFIPNDNNIFIIADFKQIELKIAAEITNDEIMLKAYNNNIDLHTLTASIITKKNIPDINKEDRHIAKAINFGLIYGMNYVNLKNYANTYYGLNMSLDQCLYFYNSFFEHYKGIYKWHNQVKQKRALQYSTLSNRKVIFPYFSFTKALNYPVQGTCADILKLALVDLYDNLKDINGKIILCVHDEIIIEVNKKFQEEALKILVQSMENSASYFLKKVKCEVSVKIAENWGSKD

Source Source

Source organism organism	Plasmodium falciparum
Common name common_name	malaria parasite P. falciparum
NCBI taxonomy ID ncbi_taxonomy_id	5833
Host organism host_organism	Escherichia coli

Entity 2 Entity 2 polymer

Description description	DNA primer strand
Molecular weight formula_weight	7715.0 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	B

CAGGTGTCAGTCAGCTAGTGCTGAC

Entity 3 Entity 3 polymer

Description description	DNA template strand
Molecular weight formula_weight	11023.1 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	C

GCTACCGTAGCGTCAGCACTAGCTGACTGACACCTG

Entity 4 Entity 4 non-polymer

Description description	2'-DEOXYGUANOSINE-5'-TRIPHOSPHATE
Molecular weight formula_weight	507.2 kDa
Source method src_method	syn
Copy count entity_count	1

▶

Unit-cell length a length_a	1.000 Å
Unit-cell length b length_b	1.000 Å
Unit-cell length c length_c	1.000 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	90.00 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	—

Space group space_group	P 1
Space-group number int_tables_number	1
Crystal system crystal_system	—

Resolution resolution	4.200 Å
Low-resolution limit resolution_low	— Å
R factor r_factor	—
R_work r_work	—
R_free r_free	—

Resolution resolution	4.20 Å
Resolution测定Method resolution_method	—
颗粒数 num_particles	10241

apPol-DNA-nucleotide complex (ternary2)

1. Protein Identity and Related Structures Protein Identity & Related Structures

Plastid replication-repair enzyme

State in the Current Structure

Other States of the Same Protein in the Database

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

9qu8__assembly_1__model_1

9qu8__assembly_1__model_1 | I(q)

9qu8__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

冷冻电镜 EM 3D

5. Entities and Polymers Entities & Polymers (4)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 polymer

Polymer Polymer

Entity 4 Entity 4 non-polymer

7. Citations (1)

apPol-DNA-nucleotide complex (ternary2)

1. Protein Identity and Related Structures Protein Identity & Related Structures

Plastid replication-repair enzyme

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

9qu8__assembly_1__model_1

9qu8__assembly_1__model_1 | I(q)

9qu8__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

冷冻电镜 EM 3D

5. Entities and Polymers Entities & Polymers (4)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 polymer

Polymer Polymer

Entity 4 Entity 4 non-polymer

7. Citations (1)