SAXSdb — 9rwb

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

Protein bicaudal D

Drosophila melanogaster

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–RNA	Heteromer	Protein 4 RNA 1	Egalitarian, isoform B × 2 （Q9W1K4） hairy localization element × 1	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	BICD_DROME
Isoform	—
PDB entities	1
Chains and sequence ranges	Author chain A； PDBConstruct 1–782； UniProt 1–782 Author chain B； PDBConstruct 1–782； UniProt 1–782

Egalitarian, isoform B

Drosophila melanogaster

UniProt Q9W1K4

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–RNA	Heteromer	Protein 4 RNA 1	Protein bicaudal D × 2 （P16568） hairy localization element × 1	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	Q9W1K4_DROME
Isoform	—
PDB entities	2
Chains and sequence ranges	Author chain C； PDBConstruct 1–1004； UniProt 1–1004 Author chain D； PDBConstruct 1–1004； UniProt 1–1004

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	9rwb
Deposition date deposition_date	2025-07-09
Structure title title	Egalitarian-BicD in complex with hSL1 and hSL2 of the hairy localization element
Keywords keywords	Complex, Transport, Localization, RNA BINDING PROTEIN; RNA BINDING PROTEIN
Experimental Method method	ELECTRON MICROSCOPY

▼

3. Official assembly/model SAXS Official SAXS Profiles

This page reads only the latest assembly calculations. Every curve maps to an explicit PDB entry, official biological assembly and coordinate model.

9rwb__assembly_1__model_1

Assembly 1 · Model 1 · CRYSOL 4.1.3-1-20251215 (887e7ef)

Download this curve (.dat)

9rwb__assembly_1__model_1 | I(q)

100 plotted points; both axes use logarithmic scales.

9rwb__assembly_1__model_1 | P(r) · Pending

P(r) will be calculated and displayed separately for the same assembly/model.

Rg（Guinier）	43.36 Å
Rg (electron density)	43.09 Å
Total Rg	43.31 Å
Atom count	7731
Residues	809
Excluded volume	130650 Å³
Maximum q	0.500 Å⁻¹

Assembly	Model	Structure unit	Oligomeric description	Status	CRYSOL	Actions
1	1	`9rwb__assembly_1__model_1`	pentameric （5）	Success	4.1.3-1-20251215 (887e7ef)	View Download

▶

4. Crystallography and Experiment 4. Crystallography & Experiment

▶

5. Entities and Polymers Entities & Polymers (3)

Entity 1 Entity 1 polymer

Description description	Protein bicaudal D
Molecular weight formula_weight	89073.5 kDa
Source method src_method	man
Copy count entity_count	2

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A,B
Atom count atom_count	7731

MSSASNNGPSADQSVQDLQMEVERLTRELDQVSSASAQSAQYGLSLLEEKSALQQKCEELETLYDNTRHELDITQEALTKFQTSQKVTNKTGIEQEDALLNESAARETSLNLQIFDLENELKQLRHELERVRNERDRMLQENSDFGRDKSDSEADRLRLKSELKDLKFRETRMLSEYSELEEENISLQKQVSSLRSSQVEFEGAKHEIRRLTEEVELLNQQVDELANLKKIAEKQMEEALETLQGEREAKYALKKELDGHLNRESMYHISNLAYSIRSNMEDNASNNSDGEEENLALKRLEADLSTELKSPDGTKCDLFSEIHLNELKKLEKQLESMESEKTHLTANLREAQTSLDKSQNELQNFMSRLALLAAHVDALVQLKKQIDVKEQGKEGGQKKDELEQQLRALISQYANWFTLSAKEIDGLKTDIAELQKGLNYTDATTTLRNEVTNLKNKLLATEQKSLDLQSDVQTLTHISQNAGQSLGSARSTLVALSDDLAQLYHLVCTVNGETPTRVLLDHKTDDMSFENDSLTAIQSQFKSDVFIAKPQIVEDLQGLADSVEIKKYVDTVSDQIKYLKTAVEHTIDMNKHKIRSEGGDALEKVNTEEMEELQEQIVKLKSLLSVKREQIGTLRNVLKSNKQTAEVALTNLKSKYENEKIIVSDTMSKLRNELRLLKEDAATFSSLRAMFAARCEEYVTQVDDLNRQLEAAEEEKKTLNQLLRLAVQQKLALTQRLEEMEMDREMRHVRRPMPAQRGTSGKSSFSTRPSSRNPASSNANPF

Source Source

Source organism organism	Drosophila melanogaster
Common name common_name	fruit fly
NCBI taxonomy ID ncbi_taxonomy_id	7227
Host organism host_organism	Spodoptera frugiperda

Entity 2 Entity 2 polymer

Description description	Egalitarian, isoform B
Molecular weight formula_weight	113198.1 kDa
Source method src_method	man
Copy count entity_count	2

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	C,D

MESMEYEMARNMTLLFFLERLLDKGEPRTVHDLSCQFGNKEFTKEMRQIAGGSQSGLKKFLAQYPAIFLVDGDYVQVNAYQHHNADDGGCGGKRDYIQEAKDYFKNKMLQYGAAAEVPVRSLLGHRSQASPQVRHISGQHIKEFTDFLMKHTDTFKVTDDYVMLVGCENMTDLPARDRLHLPQSNIDTRGTQQMLDFFAQCIEVKGPLLVDQLFHLLTTNFPQDQWLRMFKTPGDLSSFLKLFADCFHIQANLVTLLQKPKLSDTHIQQAQAQTREQFNALNNNNSASIRKQEPTPGGGGVGGVSSVQQRLQSPALRTNGHTNNNNGSNGSNNNNNNNNSIACPNFKLNAPVSNVMGGQSQGFGQPKSEPSSGFDSYVPMSELKLENLCENNYPSANTCYGPINNSSQQTQQVQTQQQQQPQHATQNPAEQRLNSVNQTLKQRINTLVIRTLAENLEKDKQSLANQQGGPISPHASPVHSIANSSSNQNAGSAANNANSNSNANPNNANHSPSHSYFVGDTWKIKVLQNTTVIANVKQSVFVTDIILKYAAKNESIVVSLDCEGINLGLKGEITLIEIGTTRGEAFLFDVQSCPAMVTDGGLKTVLEHDQVIKVIHDCRNDAANLYLQFGILLRNVFDTQAAHAILQYQESGKQVYKAKYISLNSLCEQYNAPCNPIKDQLKQIYRRDQKFWAKRPLTREMMLYAAGDVLVLIHDQLFGNLARQIKPENRALFSELCTEQILMQIKPNEVKIRKKQRKVSTEVSDLKQKLAQTSKSIVLSNREIRLLRYMDLTEDEKERLKGYYKVAKKLEKMESAGNPSKDQSDSEDEQEPNENDAFPSLDSVPSDNSLSGTFSPRFSSEPPSLTESMQMLEEILQNKSMDRIARIDKLEAILTTATSLPCEQIIASNSMQEQLGSSIATTENLQIIREKSKNIKNCNCQGERSVTPIMRTTDKRVVKLVDAESQTLSTGDVVITKIFFQDEHERAKEAALLSNSPAKRVSPTGSENLYFQ

Source Source

Source organism organism	Drosophila melanogaster
Common name common_name	fruit fly
NCBI taxonomy ID ncbi_taxonomy_id	7227
Host organism host_organism	Spodoptera frugiperda

Entity 3 Entity 3 polymer

Description description	hairy localization element
Molecular weight formula_weight	48400.6 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polyribonucleotide
Chain IDs strand_id	E

GCGCAUGCGCGUAGACAUUUCACAUCAUUCGCCGGGAUUGCGCAAAUGUUGCUUUGAAGUGUUGCAAACAUGCGAAUCCUAAACUCGGUUCACAACUUCGUUGGCUUAGUUUCCUGGCUUAUAUCCUGGAAACCCGUCGACGAGGCUAAGG

▶

Unit-cell length a length_a	1.000 Å
Unit-cell length b length_b	1.000 Å
Unit-cell length c length_c	1.000 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	90.00 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	—

Space group space_group	P 1
Space-group number int_tables_number	1
Crystal system crystal_system	—

Resolution resolution	3.400 Å
Low-resolution limit resolution_low	— Å
R factor r_factor	—
R_work r_work	—
R_free r_free	—

Resolution resolution	3.40 Å
Resolution测定Method resolution_method	—
颗粒数 num_particles	202684

Egalitarian-BicD in complex with hSL1 and hSL2 of the hairy localization element

1. Protein Identity and Related Structures Protein Identity & Related Structures

Protein bicaudal D

State in the Current Structure

Other States of the Same Protein in the Database

Egalitarian, isoform B

State in the Current Structure

Other States of the Same Protein in the Database

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

9rwb__assembly_1__model_1

9rwb__assembly_1__model_1 | I(q)

9rwb__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

冷冻电镜 EM 3D

5. Entities and Polymers Entities & Polymers (3)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Source Source

Entity 3 Entity 3 polymer

Polymer Polymer

7. Citations (1)

Egalitarian-BicD in complex with hSL1 and hSL2 of the hairy localization element

1. Protein Identity and Related Structures Protein Identity & Related Structures

Protein bicaudal D

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

Egalitarian, isoform B

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

9rwb__assembly_1__model_1

9rwb__assembly_1__model_1 | I(q)

9rwb__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

冷冻电镜 EM 3D

5. Entities and Polymers Entities & Polymers (3)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Source Source

Entity 3 Entity 3 polymer

Polymer Polymer

7. Citations (1)