← Back to search

9slz

;Structure of Thermus thermophilus lysyl-tRNA synthetase complexed with wild-type E.coli tRNALys(mnm5s2UUU) and sulphamoyl-analogue of lysyl-adenylate ;

Method: X-RAY DIFFRACTION D_max: 100.6 Å Quality: GOOD

SAXS Profile

P(r) Distribution

▼

1. Structure Basics

entry_id	9slz
deposition_date	2025-09-05
last_revision	2025-09-17
title	;Structure of Thermus thermophilus lysyl-tRNA synthetase complexed with wild-type E.coli tRNALys(mnm5s2UUU) and sulphamoyl-analogue of lysyl-adenylate ;
keywords	amino-acyl-tRNA synthetase, tRNA, aminoacyl-adenylate, RNA BINDING PROTEIN; RNA BINDING PROTEIN
method	X-RAY DIFFRACTION

▼

Download Data

SAXS curve (.dat) P(r) distribution (.pr.out) Structure (CIF)

▼

2. SAXS Parameters (CRYSOL)

rg_guinier	31.47 Å
rg_electron	30.59 Å
i0	72875800.00
molecular_weight	63455.0 kDa
excluded_volume	77794 Å³
envelope_volume	103570 Å³
shell_volume	29621 Å³
envelope_diameter	99.7 Å
shell_rg	35.95 Å
envelope_rg	30.17 Å
shape_rg	30.56 Å
total_rg	31.19 Å
total_atoms	4449
n_residues	500
n_harmonics	20
q_range	— – 0.5000 Å⁻¹
n_points	101
shell_type	directional
solvent_density	0.3340 e/Å³
contrast_shell	0.0300 e/Å³
crysol_version	4.1.3

▼

3. P(r) Analysis (GNOM)

dmax	100.6 Å
rg_real	31.66 Å
rg_real_error	1.04 Å
i0_real	7.2880e+07
i0_real_error	1.2030e+06
rg_reciprocal	31.58 Å
i0_reciprocal	72870000.0000
total_estimate	0.8543
solution_quality	GOOD a GOOD solution
n_peaks	1
r_peak_primary	26.2 Å
skewness	0.355
kurtosis	-0.795
angular_range	— – 0.2500 Å⁻¹
current_alpha	0.0000
highest_alpha	14570000.0000
n_real_points	51
gnom_version	4.1.3
quality_criteria	AN1: 0.000; Oscil: 0.783; Stabil: 1.000; Sysdev: 1.000; Positv: 1.000; Valcen: 0.844; Smooth: 0.910

▶

4. Crystallography & Experiment

▶

5. Entities & Polymer Info (4)

Entity 1 polymer

description	Lysine--tRNA ligase
formula_weight	57003.2 kDa
ec_number	6.1.1.6
src_method	man
entity_count	1

Polymer

type	polypeptide(L)
strand_id	A
atom_count	4449

MNDQTRQRLLNLEALVEAGFAPYPYRFPKTHSAEAILKAKRGAPPESEWPEEEVAVAGRLVALRRMGKVTFAHLLDETGRIQLYFQRDLTPKYELLKKLDVGDILGVRGHPFTTKTGEVTVKVLDWTPLVKSLHPLPDKWHGLRDKEVRYRQRYLDLIVNPEVREVFRRRSEIVRYIRRFFEAKGFLEVETPILQPTTGGAEARPFKTYHNALDHEFYLRISLELYLKRLLVGGYEKVFEIGRNFRNEGIDHNHNPEFTMLEAYWAYADYQDMAGLVEELLSGLVLHLFGSHEVPYQGRVLNFKPPFRRISFVEALKEKAGLPFDPLDLERLRLWADAHHPELSQVPNYKLLDKLFGIYVEPELQDPTFVFDFPLAISPLAKRHREKPGLVERWDLYAGGMELAPCYSELNDPLDQRERFLEQARRRKEGDEEAPEPDEDFLLALEYGMPPAAGLGLGIDRLAMLLTDQPSLRDVLLFPLLKPKKEAVEEGV

Source

organism	Thermus thermophilus
ncbi_taxonomy_id	274
host_organism	Escherichia coli

Entity 2 polymer

description	Wild-type E. coli tRNALys
formula_weight	24987.0 kDa
src_method	nat
entity_count	1

Polymer

type	polyribonucleotide
strand_id	T

GGGGUCGUUAGCUCAGUUGGUAGAGCAGUUGACUUUUAAUCAAUUGGUCGCAGGUUCGAAUCCUGCACGACCCACCA

Entity 3 non-polymer

description	SULFATE ION
formula_weight	96.1 kDa
src_method	syn
entity_count	7

Entity 4 non-polymer

description	5'-O-[(L-LYSYLAMINO)SULFONYL]ADENOSINE
formula_weight	474.5 kDa
src_method	syn
entity_count	1

▶

6. Citations (2)

▶

length_a	147.300 Å
length_b	147.300 Å
length_c	127.450 Å
angle_alpha	90.00 °
angle_beta	90.00 °
angle_gamma	120.00 °
z_pdb	6

space_group	P 31 2 1
int_tables_number	152
crystal_system	—

resolution	3.800 Å
resolution_low	19.929 Å
r_factor	—
r_work	0.2117
r_free	0.2366

fit	/app/data/saxs_computation/sl/9slz/9slz.fit
pddf	/app/data/pr_computation/sl/9slz/9slz.pr.out
profile	/app/data/saxs_computation/sl/9slz/9slz.dat

;Structure of Thermus thermophilus lysyl-tRNA synthetase complexed with wild-type E.coli tRNALys(mnm5s2UUU) and sulphamoyl-analogue of lysyl-adenylate ;

SAXS Profile

P(r) Distribution

1. Structure Basics

Download Data

2. SAXS Parameters (CRYSOL)

3. P(r) Analysis (GNOM)

4. Crystallography & Experiment

Unit Cell

Symmetry

Refinement

Diffraction

5. Entities & Polymer Info (4)

Entity 1 polymer

Polymer

Source

Entity 2 polymer

Polymer

Entity 3 non-polymer

Entity 4 non-polymer

6. Citations (2)

7. Files & Curves (10)

Files (7)

Curves (3)