SAXSdb — 9slz

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

Lysine--tRNA ligase

Thermus thermophilus

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–RNA	Monomer	Protein 1 RNA 1	Wild-type E. coli tRNALys × 1 SULFATE ION × 7 5'-O-[(L-LYSYLAMINO)SULFONYL]ADENOSINE × 1	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	SYK_THET8
Isoform	—
PDB entities	1
Chains and sequence ranges	Author chain A； PDBConstruct 1–492； UniProt 1–492

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	9slz
Deposition date deposition_date	2025-09-05
Last revision last_revision	2025-09-17
Structure title title	Structure of Thermus thermophilus lysyl-tRNA synthetase complexed with wild-type E.coli tRNALys(mnm5s2UUU) and sulphamoyl-analogue of lysyl-adenylate
Keywords keywords	amino-acyl-tRNA synthetase, tRNA, aminoacyl-adenylate, RNA BINDING PROTEIN; RNA BINDING PROTEIN
Experimental Method method	X-RAY DIFFRACTION

▼

3. Official assembly/model SAXS Official SAXS Profiles

This page reads only the latest assembly calculations. Every curve maps to an explicit PDB entry, official biological assembly and coordinate model.

9slz__assembly_1__model_1

Assembly 1 · Model 1 · CRYSOL 4.1.3-1-20251215 (887e7ef)

Download this curve (.dat)

9slz__assembly_1__model_1 | I(q)

100 plotted points; both axes use logarithmic scales.

9slz__assembly_1__model_1 | P(r) · Pending

P(r) will be calculated and displayed separately for the same assembly/model.

Rg（Guinier）	31.47 Å
Rg (electron density)	30.59 Å
Total Rg	31.19 Å
Atom count	4449
Residues	500
Excluded volume	77794 Å³
Maximum q	0.500 Å⁻¹

Assembly	Model	Structure unit	Oligomeric description	Status	CRYSOL	Actions
1	1	`9slz__assembly_1__model_1`	dimeric （2）	Success	4.1.3-1-20251215 (887e7ef)	View Download

▶

4. Crystallography and Experiment 4. Crystallography & Experiment

▶

5. Entities and Polymers Entities & Polymers (4)

Entity 1 Entity 1 polymer

Description description	Lysine--tRNA ligase
Molecular weight formula_weight	57003.2 kDa
EC 编号 ec_number	6.1.1.6
Source method src_method	man
Copy count entity_count	1

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A
Atom count atom_count	4449

MNDQTRQRLLNLEALVEAGFAPYPYRFPKTHSAEAILKAKRGAPPESEWPEEEVAVAGRLVALRRMGKVTFAHLLDETGRIQLYFQRDLTPKYELLKKLDVGDILGVRGHPFTTKTGEVTVKVLDWTPLVKSLHPLPDKWHGLRDKEVRYRQRYLDLIVNPEVREVFRRRSEIVRYIRRFFEAKGFLEVETPILQPTTGGAEARPFKTYHNALDHEFYLRISLELYLKRLLVGGYEKVFEIGRNFRNEGIDHNHNPEFTMLEAYWAYADYQDMAGLVEELLSGLVLHLFGSHEVPYQGRVLNFKPPFRRISFVEALKEKAGLPFDPLDLERLRLWADAHHPELSQVPNYKLLDKLFGIYVEPELQDPTFVFDFPLAISPLAKRHREKPGLVERWDLYAGGMELAPCYSELNDPLDQRERFLEQARRRKEGDEEAPEPDEDFLLALEYGMPPAAGLGLGIDRLAMLLTDQPSLRDVLLFPLLKPKKEAVEEGV

Source Source

Source organism organism	Thermus thermophilus
NCBI taxonomy ID ncbi_taxonomy_id	274
Host organism host_organism	Escherichia coli

Entity 2 Entity 2 polymer

Description description	Wild-type E. coli tRNALys
Molecular weight formula_weight	24987.0 kDa
Source method src_method	nat
Copy count entity_count	1

Polymer Polymer

Polymer type type	polyribonucleotide
Chain IDs strand_id	T

GGGGUCGUUAGCUCAGUUGGUAGAGCAGUUGACUUUUAAUCAAUUGGUCGCAGGUUCGAAUCCUGCACGACCCACCA

Entity 3 Entity 3 non-polymer

Description description	SULFATE ION
Molecular weight formula_weight	96.1 kDa
Source method src_method	syn
Copy count entity_count	7

Entity 4 Entity 4 non-polymer

Description description	5'-O-[(L-LYSYLAMINO)SULFONYL]ADENOSINE
Molecular weight formula_weight	474.5 kDa
Source method src_method	syn
Copy count entity_count	1

▶

Unit-cell length a length_a	147.300 Å
Unit-cell length b length_b	147.300 Å
Unit-cell length c length_c	127.450 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	90.00 °
Unit-cell angle γ angle_gamma	120.00 °
Molecules per unit cell Z z_pdb	6

Space group space_group	P 31 2 1
Space-group number int_tables_number	152
Crystal system crystal_system	—

Resolution resolution	3.800 Å
Low-resolution limit resolution_low	19.929 Å
R factor r_factor	—
R_work r_work	0.2117
R_free r_free	0.2366

Structure of Thermus thermophilus lysyl-tRNA synthetase complexed with wild-type E.coli tRNALys(mnm5s2UUU) and sulphamoyl-analogue of lysyl-adenylate

1. Protein Identity and Related Structures Protein Identity & Related Structures

Lysine--tRNA ligase

State in the Current Structure

Other States of the Same Protein in the Database

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

9slz__assembly_1__model_1

9slz__assembly_1__model_1 | I(q)

9slz__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (4)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 non-polymer

Entity 4 Entity 4 non-polymer

7. Citations (2)

Structure of Thermus thermophilus lysyl-tRNA synthetase complexed with wild-type E.coli tRNALys(mnm5s2UUU) and sulphamoyl-analogue of lysyl-adenylate

1. Protein Identity and Related Structures Protein Identity & Related Structures

Lysine--tRNA ligase

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

9slz__assembly_1__model_1

9slz__assembly_1__model_1 | I(q)

9slz__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (4)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 non-polymer

Entity 4 Entity 4 non-polymer

7. Citations (2)