9t56

Cryo-EM structure of ISCro4-DBL-TBL-tDNA-dDNA synaptic complex

Method: ELECTRON MICROSCOPY

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

ISCro4 transposase

Citrobacter rodentium ICC168

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Other combination	Homooligomer	Protein 4 DNA 4 RNA 2	Target-binding loop (TBL) RNA × 1 Donor-binding loop (DBL) RNA × 1 target DNA (tRNA) top strand × 1 target DNA (tDNA) bottom strand × 1 donor DNA (dDNA) top strand × 1 donor DNA (dDNA) bottom strand × 1 MAGNESIUM ION × 2	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	D2TGM5_CITRI
Isoform	—
PDB entities	1
Chains and sequence ranges	Author chain A； PDBConstruct 4–329； UniProt 1–326 Author chain B； PDBConstruct 4–329； UniProt 1–326 Author chain C； PDBConstruct 4–329； UniProt 1–326 Author chain D； PDBConstruct 4–329； UniProt 1–326

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	9t56
Deposition date deposition_date	2025-11-04
Structure title title	Cryo-EM structure of ISCro4-DBL-TBL-tDNA-dDNA synaptic complex
Keywords keywords	Nucleic acid interaction, RNA binding, DNA binding, tetramer, recombination, recombinase; RECOMBINATION
Experimental Method method	ELECTRON MICROSCOPY

▼

3. Official assembly/model SAXS Official SAXS Profiles

This page reads only the latest assembly calculations. Every curve maps to an explicit PDB entry, official biological assembly and coordinate model.

9t56__assembly_1__model_1

Assembly 1 · Model 1 · CRYSOL 4.1.3-1-20251215 (887e7ef)

Download this curve (.dat)

9t56__assembly_1__model_1 | I(q)

100 plotted points; both axes use logarithmic scales.

9t56__assembly_1__model_1 | P(r) · Pending

P(r) will be calculated and displayed separately for the same assembly/model.

Rg（Guinier）	37.35 Å
Rg (electron density)	36.80 Å
Total Rg	37.16 Å
Atom count	14212
Residues	1461
Excluded volume	237410 Å³
Maximum q	0.500 Å⁻¹

Assembly	Model	Structure unit	Oligomeric description	Status	CRYSOL	Actions
1	1	`9t56__assembly_1__model_1`	decameric （10）	Success	4.1.3-1-20251215 (887e7ef)	View Download

▶

4. Crystallography and Experiment 4. Crystallography & Experiment

▶

5. Entities and Polymers Entities & Polymers (8)

Entity 1 Entity 1 polymer

Description description	ISCro4 transposase
Molecular weight formula_weight	38131.7 kDa
Source method src_method	man
Copy count entity_count	4

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A,B,C,D
Atom count atom_count	14212

SNAMEQELHFIGIDVSKAKLDVDVLRPDGRHRSKKFANTPKGHDELLRWLSGHRVAPAHICMEATSTYMEDVAAHLSDAGYTVSVINPALGKAFAQSEGLRSKTDAVDARMLAEFCRQKRPPAWEAPHPVERALRALVLRHQSLTDMHTQELNRLETAREVQRPSIDAHLLWLHAELKRIEKQIKDLTDDDPDMKHRRKLLESIPGIGEKTSAVLLAYTGLKERFTHARQFAAFAGLTPRRYESGSSVNRASRMSKAGHASLRRALYMPAMVAVSKTEWGRAFRDRLAGNGKKGKVIIGAMMRKLAQVAYGVLKSGVPFDASRHNPVAASSGSLEHHHHHH

Source Source

Source organism organism	Citrobacter rodentium ICC168
NCBI taxonomy ID ncbi_taxonomy_id	637910
Host organism host_organism	Escherichia coli

Entity 2 Entity 2 polymer

Description description	Target-binding loop (TBL) RNA
Molecular weight formula_weight	35682.1 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polyribonucleotide
Chain IDs strand_id	E

GGGAGUGCAGGGAGAACCGGCCAGUUCUCUCUGCCAUGCGGUCCGCAUGCCGUAUCAGGCCUCAGGCUAAUAACCUGUGACGUAGAUUUAUGCAGCGGACCGCCGUUUUUU

Entity 3 Entity 3 polymer

Description description	Donor-binding loop (DBL) RNA
Molecular weight formula_weight	25278.9 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polyribonucleotide
Chain IDs strand_id	F

GGGCAAGUGACAAACCGGACAGUAUCAUGGACCGGUUUUCCCGGUAAUCCGCAUUCACAAGGCUGGUCUCACUUUUUUU

Entity 4 Entity 4 polymer

Description description	target DNA (tRNA) top strand
Molecular weight formula_weight	11616.5 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	G

GCCGGGTAATACCCTTATCAGGCCTACGTCACAGCTCG

Entity 5 Entity 5 polymer

Description description	target DNA (tDNA) bottom strand
Molecular weight formula_weight	11776.6 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	H

CGAGCTGTGACGTAGGCCTGATAAGGGTATTACCCGGC

Entity 6 Entity 6 polymer

Description description	donor DNA (dDNA) top strand
Molecular weight formula_weight	13562.7 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	I

TGCAGGCGATAACAGTATCTTGTATTATCCCTTCAGTGCAGAGA

Entity 7 Entity 7 polymer

Description description	donor DNA (dDNA) bottom strand
Molecular weight formula_weight	13531.7 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	J

TCTCTGCACTGAAGGGATAATACAAGATACTGTTATCGCCTGCA

Entity 8 Entity 8 non-polymer

Description description	MAGNESIUM ION
Molecular weight formula_weight	24.3 kDa
Source method src_method	syn
Copy count entity_count	2

▶

Unit-cell length a length_a	1.000 Å
Unit-cell length b length_b	1.000 Å
Unit-cell length c length_c	1.000 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	90.00 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	—

Space group space_group	P 1
Space-group number int_tables_number	1
Crystal system crystal_system	—

Resolution resolution	2.810 Å
Low-resolution limit resolution_low	— Å
R factor r_factor	—
R_work r_work	—
R_free r_free	—

Resolution resolution	2.81 Å
Resolution测定Method resolution_method	—
颗粒数 num_particles	268987

Cryo-EM structure of ISCro4-DBL-TBL-tDNA-dDNA synaptic complex

1. Protein Identity and Related Structures Protein Identity & Related Structures

ISCro4 transposase

State in the Current Structure

Other States of the Same Protein in the Database

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

9t56__assembly_1__model_1

9t56__assembly_1__model_1 | I(q)

9t56__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

冷冻电镜 EM 3D

5. Entities and Polymers Entities & Polymers (8)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 polymer

Polymer Polymer

Entity 4 Entity 4 polymer

Polymer Polymer

Entity 5 Entity 5 polymer

Polymer Polymer

Entity 6 Entity 6 polymer

Polymer Polymer

Entity 7 Entity 7 polymer

Polymer Polymer

Entity 8 Entity 8 non-polymer

7. Citations (1)

Cryo-EM structure of ISCro4-DBL-TBL-tDNA-dDNA synaptic complex

1. Protein Identity and Related Structures Protein Identity & Related Structures

ISCro4 transposase

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

9t56__assembly_1__model_1

9t56__assembly_1__model_1 | I(q)

9t56__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

冷冻电镜 EM 3D

5. Entities and Polymers Entities & Polymers (8)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 polymer

Polymer Polymer

Entity 4 Entity 4 polymer

Polymer Polymer

Entity 5 Entity 5 polymer

Polymer Polymer

Entity 6 Entity 6 polymer

Polymer Polymer

Entity 7 Entity 7 polymer

Polymer Polymer

Entity 8 Entity 8 non-polymer

7. Citations (1)