← Back to search

9vcb

Cryo-EM structure of Shewanella putrefaciens ComEC in complex with ssDNA

Method: ELECTRON MICROSCOPY D_max: 102.5 Å Quality: GOOD

SAXS Profile

P(r) Distribution

▼

1. Structure Basics

entry_id	9vcb
deposition_date	2025-06-05
title	Cryo-EM structure of Shewanella putrefaciens ComEC in complex with ssDNA
keywords	Competence, DNA channel, Membrane protein, Hydrolase; MEMBRANE PROTEIN
method	ELECTRON MICROSCOPY

▼

Download Data

SAXS curve (.dat) P(r) distribution (.pr.out) Structure (CIF)

▼

2. SAXS Parameters (CRYSOL)

rg_guinier	28.84 Å
rg_electron	28.49 Å
i0	93168500.00
molecular_weight	80365.0 kDa
excluded_volume	102470 Å³
envelope_volume	125040 Å³
shell_volume	36646 Å³
envelope_diameter	109.8 Å
shell_rg	35.67 Å
envelope_rg	28.75 Å
shape_rg	28.47 Å
total_rg	29.27 Å
total_atoms	5665
n_residues	712
n_harmonics	20
q_range	— – 0.5000 Å⁻¹
n_points	101
shell_type	directional
solvent_density	0.3340 e/Å³
contrast_shell	0.0300 e/Å³
crysol_version	4.1.3

▼

3. P(r) Analysis (GNOM)

dmax	102.5 Å
rg_real	28.86 Å
rg_real_error	0.85 Å
i0_real	9.3170e+07
i0_real_error	1.3810e+06
rg_reciprocal	28.85 Å
i0_reciprocal	93170000.0000
total_estimate	0.8514
solution_quality	GOOD a GOOD solution
n_peaks	2
r_peak_primary	31.7 Å
skewness	0.433
kurtosis	-0.129
angular_range	— – 0.2750 Å⁻¹
current_alpha	0.0000
highest_alpha	30050000.0000
n_real_points	56
gnom_version	4.1.3
quality_criteria	AN1: 0.000; Oscil: 0.719; Stabil: 1.000; Sysdev: 1.000; Positv: 1.000; Valcen: 0.913; Smooth: 0.994

▶

4. Crystallography & Experiment

▶

5. Entities & Polymer Info (3)

Entity 1 polymer

description	DNA internalization-related competence protein ComEC/Rec2
formula_weight	89194.5 kDa
mutation	D577A, D579A
src_method	man
entity_count	1

Polymer

type	polypeptide(L)
strand_id	A
atom_count	5665

MGHHHHHHHHHHSSGENLYFQGSGSMNRFILGFSASLLSAMLWPSLPPVAYLPYLLVGALILYQKAPLCSGVLFAMLWLTVFCLGLSRQDLPVQQQPLQVRGEIISLVSQNSDWLSLDIAIIKPNLILRPRAKLRLTWKAPPDVAVGQVWLFTITPKSVSNVLNQGGYNEQKQLISQHIVGKGRVIKAELIESQPSLRNQLVSALAPQLAPLQQGDLLLALILGDKQLISSERWQMLRQTATGHLVAISGLHLSVVTAWIYAVMIFGLTRFVPHPSRRNWVFALLLSGIGAAFYAYLAGFGISTQRALVMILLLMLLSLLKRFSSPWERLLFALFMVLLIDPLACLSAGFWLSFCALAIILYTLEAAPKVHQLTNDITPLGRVRAGLLQFWSIQWRLSLGLGFVQAVLFGGISAHSLWINMLAVPWFSFVVIPIAMAGFVCWWIGTALGFSWMGLLELSNWALMPYGQLLAISGQLPIHWQVVSESVLALALCGVLGGVLWRYIPKQRLYWPWRFIVSLLFVPFLLSFLLKWLPLKSATWSMHLLDVGQGLAVVIEKEGRGLIYDTGAAFGESFSYSQRVIIPFLNAKGIREIDYVFISHSANAHAGGASALLAAYPKAQWITDVTEIAGKGCRPQQINWQDLKISIIFPQKPIAGNNGSCVVRIDDTQQRVLLTGDIEKNSEMKLLTQVKMQPTILMSQVLIAPHHGSKSSSTEAFIDAVSPELVLFPAGLGNRYGFPKPVVVDRYQARNIPHLTTGIEGQISVIFRHDSREVKTYRRDLAPFWYNRLFRFGDLINPE

Source

organism	Shewanella putrefaciens
ncbi_taxonomy_id	24
host_organism	Escherichia coli

Entity 2 polymer

description	DNA (30-MER)
formula_weight	9178.0 kDa
src_method	syn
entity_count	1

Polymer

type	polydeoxyribonucleotide
strand_id	B

CCCGCAGCAATGTACAAATAACATAACAGT

Entity 3 non-polymer

description	ZINC ION
formula_weight	65.4 kDa
src_method	syn
entity_count	1

▶

6. Citations (1)

▶

length_a	1.000 Å
length_b	1.000 Å
length_c	1.000 Å
angle_alpha	90.00 °
angle_beta	90.00 °
angle_gamma	90.00 °
z_pdb	—

space_group	P 1
int_tables_number	1
crystal_system	—

resolution	2.82 Å
resolution_method	—
num_particles	122471

fit	/app/data/saxs_computation/vc/9vcb/9vcb.fit
pddf	/app/data/pr_computation/vc/9vcb/9vcb.pr.out
profile	/app/data/saxs_computation/vc/9vcb/9vcb.dat

Cryo-EM structure of Shewanella putrefaciens ComEC in complex with ssDNA

SAXS Profile

P(r) Distribution

1. Structure Basics

Download Data

2. SAXS Parameters (CRYSOL)

3. P(r) Analysis (GNOM)

4. Crystallography & Experiment

Unit Cell

Symmetry

EM 3D

5. Entities & Polymer Info (3)

Entity 1 polymer

Polymer

Source

Entity 2 polymer

Polymer

Entity 3 non-polymer

6. Citations (1)

7. Files & Curves (10)

Files (7)

Curves (3)