SAXSdb — 9xcf

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

CRISPR-associated protein Csy3

Pectobacterium atrosepticum SCRI1043

State in the Current Structure

Assembly	Oligomeric State	Construct	Mutations and Modifications	Ligands, Ions and Associated Components	Method and Experimental Conditions	Structure Quality
1	Protein–RNA Homooligomer Protein × 30 RNA 1 PDB declaration: 31-meric（31） Consistent with all polymer counts	Chain A； UniProt 1–337 Chain B； UniProt 1–337 Chain C； UniProt 1–337 Chain D； UniProt 1–337 Chain E； UniProt 1–337 Chain F； UniProt 1–337 Chain G； UniProt 1–337 Chain H； UniProt 1–337 Chain I； UniProt 1–337 Chain J； UniProt 1–337 Chain K； UniProt 1–337 Chain L； UniProt 1–337 Chain N； UniProt 1–337 Chain O； UniProt 1–337 Chain P； UniProt 1–337 Chain Q； UniProt 1–337 Chain S； UniProt 1–337 Chain T； UniProt 1–337 Chain U； UniProt 1–337 Chain V； UniProt 1–337 Chain W； UniProt 1–337 Chain Y； UniProt 1–337 Chain Z； UniProt 1–337 Chain a； UniProt 1–337 Chain b； UniProt 1–337 Chain f； UniProt 1–337 Chain i； UniProt 1–337 Chain o； UniProt 1–337 Chain p； UniProt 1–337 Chain q； UniProt 1–337	Not recorded	RNA (185-MER) × 1	ELECTRON MICROSCOPY cryo-EM buffer：pH 7.4 cryo-EM vitrification conditions：Cryogen ETHANE	Resolution 4.58 Å

Other States of the Same Protein in the Database

Each row is a biological assembly of the same UniProt protein in another PDB entry. The “Difference from current entry” column identifies evidence-level differences; no tag means the currently parsed fields agree.

Other PDB	Difference from Current Entry 9XCF	Assembly / Oligomeric State	Construct	Mutations and Modifications	Ligands, Ions and Non-polymers	Method and Experimental Conditions	Structure Quality
9IRF Cryo-EM Structure of csy1-4 with crRNA Deposited 2024-07-15	Different construct Different mutation/modification Different oligomeric state Different structure-quality metrics	Assembly 1 Protein–RNA Heteromer；Protein × 9 PDB declaration: decameric	Chain C 1–337（337 aa） Chain D 1–337（337 aa） Chain E 1–337（337 aa） Chain F 1–337（337 aa） Chain G 1–337（337 aa） Chain H 1–337（337 aa）	Not recorded	No recorded non-water small molecule	ELECTRON MICROSCOPY cryo-EM buffer pH 7.4 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 2.80 Å
9IRG Cryo-EM Structure of RNA Deposited 2024-07-16	Different construct Different mutation/modification Different oligomeric state Different structure-quality metrics	Assembly 1 Protein–RNA Homooligomer；Protein × 26 PDB declaration: 27-meric	Chain A 1–337（337 aa） Chain B 1–337（337 aa） Chain C 1–337（337 aa） Chain D 1–337（337 aa） Chain E 1–337（337 aa） Chain F 1–337（337 aa） Chain G 1–337（337 aa） Chain H 1–337（337 aa） Chain I 1–337（337 aa） Chain J 1–337（337 aa） Chain K 1–337（337 aa） Chain L 1–337（337 aa） Chain N 1–337（337 aa） Chain O 1–337（337 aa） Chain P 1–337（337 aa） Chain Q 1–337（337 aa） Chain S 1–337（337 aa） Chain T 1–337（337 aa） Chain U 1–337（337 aa） Chain V 1–337（337 aa） Chain W 1–337（337 aa） Chain Y 1–337（337 aa） Chain Z 1–337（337 aa） Chain a 1–337（337 aa） Chain b 1–337（337 aa） Chain f 1–337（337 aa）	Not recorded	No recorded non-water small molecule	ELECTRON MICROSCOPY cryo-EM buffer pH 7.4 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 4.59 Å
9IRI Cryo-EM Structure of D-RNA Deposited 2024-07-16	Different construct Different mutation/modification Different oligomeric state Different structure-quality metrics	Assembly 1 Protein–RNA Heteromer；Protein × 10 PDB declaration: undecameric	Chain A 1–337（337 aa） Chain C 1–337（337 aa） Chain D 1–337（337 aa） Chain E 1–337（337 aa） Chain F 1–337（337 aa） Chain G 1–337（337 aa） Chain I 1–337（337 aa） Chain J 1–337（337 aa） Chain K 1–337（337 aa）	Not recorded	No recorded non-water small molecule	ELECTRON MICROSCOPY cryo-EM buffer pH 7.4 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 2.80 Å
9XCG Cryo-EM structure of csy3 with crRNA Deposited 2025-10-25	Different construct Different mutation/modification Different oligomeric state Different structure-quality metrics	Assembly 1 Protein–RNA Homooligomer；Protein × 26 PDB declaration: 27-meric	Chain A 1–337（337 aa） Chain B 1–337（337 aa） Chain C 1–337（337 aa） Chain D 1–337（337 aa） Chain E 1–337（337 aa） Chain F 1–337（337 aa） Chain G 1–337（337 aa） Chain H 1–337（337 aa） Chain I 1–337（337 aa） Chain J 1–337（337 aa） Chain K 1–337（337 aa） Chain L 1–337（337 aa） Chain N 1–337（337 aa） Chain O 1–337（337 aa） Chain P 1–337（337 aa） Chain Q 1–337（337 aa） Chain S 1–337（337 aa） Chain T 1–337（337 aa） Chain U 1–337（337 aa） Chain V 1–337（337 aa） Chain W 1–337（337 aa） Chain Y 1–337（337 aa） Chain Z 1–337（337 aa） Chain a 1–337（337 aa） Chain b 1–337（337 aa） Chain f 1–337（337 aa）	Not recorded	No recorded non-water small molecule	ELECTRON MICROSCOPY cryo-EM buffer pH 7.4 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 4.85 Å

4 other PDB entries and 4 assemblies. Open the comparison page and filter oligomeric states

View Construct and Data Evidence

UniProt name	CSY3_PECAS
Isoform	—
PDB entities	1
Chains and sequence ranges	Author chain A； PDBConstruct 1–337； UniProt 1–337 Author chain B； PDBConstruct 1–337； UniProt 1–337 Author chain C； PDBConstruct 1–337； UniProt 1–337 Author chain D； PDBConstruct 1–337； UniProt 1–337 Author chain E； PDBConstruct 1–337； UniProt 1–337 Author chain F； PDBConstruct 1–337； UniProt 1–337 Author chain G； PDBConstruct 1–337； UniProt 1–337 Author chain H； PDBConstruct 1–337； UniProt 1–337 Author chain I； PDBConstruct 1–337； UniProt 1–337 Author chain J； PDBConstruct 1–337； UniProt 1–337 Author chain K； PDBConstruct 1–337； UniProt 1–337 Author chain L； PDBConstruct 1–337； UniProt 1–337 Author chain N； PDBConstruct 1–337； UniProt 1–337 Author chain O； PDBConstruct 1–337； UniProt 1–337 Author chain P； PDBConstruct 1–337； UniProt 1–337 Author chain Q； PDBConstruct 1–337； UniProt 1–337 Author chain S； PDBConstruct 1–337； UniProt 1–337 Author chain T； PDBConstruct 1–337； UniProt 1–337 Author chain U； PDBConstruct 1–337； UniProt 1–337 Author chain V； PDBConstruct 1–337； UniProt 1–337 Author chain W； PDBConstruct 1–337； UniProt 1–337 Author chain Y； PDBConstruct 1–337； UniProt 1–337 Author chain Z； PDBConstruct 1–337； UniProt 1–337 Author chain a； PDBConstruct 1–337； UniProt 1–337 Author chain b； PDBConstruct 1–337； UniProt 1–337 Author chain f； PDBConstruct 1–337； UniProt 1–337 Author chain i； PDBConstruct 1–337； UniProt 1–337 Author chain o； PDBConstruct 1–337； UniProt 1–337 Author chain p； PDBConstruct 1–337； UniProt 1–337 Author chain q； PDBConstruct 1–337； UniProt 1–337

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	9xcf
Deposition date deposition_date	2025-10-25
Structure title title	Cryo-EM structure of csy3 with crRNA
Keywords keywords	CRISPR-Cas system, IMMUNE SYSTEM/RNA, IMMUNE SYSTEM-RNA complex; IMMUNE SYSTEM/RNA
Experimental Method method	ELECTRON MICROSCOPY

▼

3. SAXS Parameters (CRYSOL theoretical calculation) 3. SAXS Parameters (CRYSOL)

Radius of gyration Rg (Guinier) rg_guinier	— Å
Radius of gyration Rg (electron density) rg_electron	107.20 Å
Forward intensity I(0) i0	19428800000.00
Molecular weight molecular_weight	1138900.0 kDa
Excluded volume excluded_volume	1405300 Å³
Envelope volume envelope_volume	2605500 Å³
Hydration-shell volume shell_volume	225420 Å³
Envelope diameter envelope_diameter	381.7 Å
Shell Rg shell_rg	83.91 Å
Envelope Rg envelope_rg	102.90 Å
Shape Rg shape_rg	107.20 Å
Total Rg total_rg	106.90 Å
Total atoms total_atoms	155526
Residues n_residues	10017
Spherical-harmonic order n_harmonics	20
q range q_range	— – 0.5000 Å⁻¹
Data points n_points	101
Shell type shell_type	directional
Solvent electron density solvent_density	0.3340 e/Å³
Shell contrast contrast_shell	0.0300 e/Å³
CRYSOL version crysol_version	4.1.3

▼

4. P(r) Distance Distribution (GNOM inversion) 4. P(r) Analysis (GNOM)

Maximum dimension Dmax dmax	299.7 Å
Rg (real space) rg_real	99.96 Å
Rg uncertainty (real space) rg_real_error	1.72 Å
I(0) (real space) i0_real	1.8780e+10
I(0) uncertainty (real space) i0_real_error	4.4990e+08
Rg (reciprocal space) rg_reciprocal	95.17 Å
I(0) (reciprocal space) i0_reciprocal	18810000000.0000
Solution quality estimate total_estimate	0.8872
Solution quality rating solution_quality	GOOD a GOOD solution
P(r) peaks n_peaks	1
Primary peak position r_peak_primary	85.6 Å
Skewness Skewness skewness	0.524
Kurtosis Kurtosis kurtosis	-0.528
Angular range angular_range	— – 0.0700 Å⁻¹
Current regularization parameter α current_alpha	0.3676
Highest regularization parameter α highest_alpha	7208000000.0000
Real-space data points n_real_points	15
GNOM version gnom_version	4.1.3
Quality Criteria quality_criteria	AN1: 0.003; Oscil: 0.841; Stabil: 0.997; Sysdev: 1.000; Positv: 1.000; Valcen: 0.994; Smooth: 0.028

▶

5. Crystallography and Experiment 5. Crystallography & Experiment

▶

6. Entities and Polymers Entities & Polymers (2)

Entity 1 Entity 1 polymer

Description description	CRISPR-associated protein Csy3
Molecular weight formula_weight	36948.5 kDa
Source method src_method	man
Copy count entity_count	30

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A,C,D,E,F,G,I,J,K,L,B,H,N,O,P,Q,S,T,U,V,W,Y,Z,a,b,f,i,o,p,q
Atom count atom_count	155526

MAKAATTLKTASVLAFERKLANSDALMYAGNWAQQDNWTAIAIQEKSVRGTISNRLKNALTSDPAKLDAEIQKANLQKVDVAALPFGADTLKIVFTLRVLGNLAQPSVCNDQDYQTALGDIITGYAQEQGFSTLAARYAENIANGRFLWRNRVGAEAIRVVVTKKGERSWEFNGEDYSLRQFSQPAGDLAALTQAIEKGLAGDASALFTVEAYVQLGNGQEVFPSQELVLDEKARNGKSKILYQVNDVAAIHSQKIGNALRTIDDWYPAADEAGPIAVEPYGSVTSRGKAYRQPREKMDFYTLLDNWVIKGDVPMPEQQHYVIATLIRGGVFGEKGE

来源 Source

来源生物 organism	Pectobacterium atrosepticum SCRI1043
通用名 common_name	Erwinia carotovora subsp. atroseptica
NCBI Class编号 ncbi_taxonomy_id	218491
宿主生物 host_organism	Escherichia coli BL21(DE3)

Entity 2 Entity 2 polymer

Description description	RNA (185-MER)
Molecular weight formula_weight	59971.7 kDa
Source method src_method	man
Copy count entity_count	1

Polymer Polymer

Polymer type type	polyribonucleotide
Chain IDs strand_id	M

CGGGAUUCACGGCGGGCUUGAAAUUCACGGCGAAAGCGGGCUUGAAAUUCACGGCGAAAUUCACGGCGGGCUUGAAAUUCACGGCGGGAUUCACGGCGGGCUUGAAAUUCACGGCGAAAUUCACGGCGGGCUUGAAAUUCACGGCGAAAUUCACGGCGGGCUUGAAAUUCACGGCGGGAUUCACG

来源 Source

来源生物 organism	Thiocystis violascens
NCBI Class编号 ncbi_taxonomy_id	73141
宿主生物 host_organism	Escherichia coli BL21(DE3)

▶

8. Citations (1)

▶

Unit-cell length a length_a	1.000 Å
Unit-cell length b length_b	1.000 Å
Unit-cell length c length_c	1.000 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	90.00 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	—

Space group space_group	P 1
Space-group number int_tables_number	1
Crystal system crystal_system	—

Resolution resolution	4.58 Å
Resolution测定方法 resolution_method	—
颗粒数 num_particles	168817

fit	/app/data/saxs_computation/xc/9xcf/9xcf.fit
pddf	/app/data/pr_computation/xc/9xcf/9xcf.pr.out
profile	/app/data/saxs_computation/xc/9xcf/9xcf.dat

Cryo-EM structure of csy3 with crRNA

1. Protein Identity and Related Structures Protein Identity & Related Structures

CRISPR-associated protein Csy3

State in the Current Structure

Other States of the Same Protein in the Database

SAXS scattering curve SAXS Profile

P(r) Distance Distribution P(r) Distribution

2. Structure Basics 2. Structure Basics

3. SAXS Parameters (CRYSOL theoretical calculation) 3. SAXS Parameters (CRYSOL)

4. P(r) Distance Distribution (GNOM inversion) 4. P(r) Analysis (GNOM)

5. Crystallography and Experiment 5. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

冷冻电镜 EM 3D

6. Entities and Polymers Entities & Polymers (2)

Entity 1 Entity 1 polymer

Polymer Polymer

来源 Source

Entity 2 Entity 2 polymer

Polymer Polymer

来源 Source

8. Citations (1)

9. Files and Curves (10)

Files (7)

Curves (3)