← Back to search

9yrl

Cryo-EM structure of SARS-CoV-2 nsp10-nsp14 (E191A) in complex with T20P14-B complex, protomer A focused refinement

Method: ELECTRON MICROSCOPY D_max: 120.7 Å Quality: GOOD

SAXS Profile

P(r) Distribution

▼

1. Structure Basics

entry_id	9yrl
deposition_date	2025-10-16
title	Cryo-EM structure of SARS-CoV-2 nsp10-nsp14 (E191A) in complex with T20P14-B complex, protomer A focused refinement
keywords	;SARS-CoV-2, replication and transcription, mismatch, proofreading exoribonuclease, VIRAL PROTEIN, VIRAL PROTEIN-RNA complex, nucleoside analog ;; VIRAL PROTEIN/RNA
method	ELECTRON MICROSCOPY

▼

Download Data

SAXS curve (.dat) P(r) distribution (.pr.out) Structure (CIF)

▼

2. SAXS Parameters (CRYSOL)

rg_guinier	34.35 Å
rg_electron	34.33 Å
i0	133545000.00
molecular_weight	83624.0 kDa
excluded_volume	100560 Å³
envelope_volume	135670 Å³
shell_volume	35505 Å³
envelope_diameter	120.8 Å
shell_rg	37.96 Å
envelope_rg	34.55 Å
shape_rg	34.28 Å
total_rg	34.72 Å
total_atoms	5798
n_residues	677
n_harmonics	20
q_range	— – 0.5000 Å⁻¹
n_points	101
shell_type	directional
solvent_density	0.3340 e/Å³
contrast_shell	0.0300 e/Å³
crysol_version	4.1.3

▼

3. P(r) Analysis (GNOM)

dmax	120.7 Å
rg_real	34.62 Å
rg_real_error	1.37 Å
i0_real	1.3350e+08
i0_real_error	2.3000e+06
rg_reciprocal	34.45 Å
i0_reciprocal	133500000.0000
total_estimate	0.8476
solution_quality	GOOD a GOOD solution
n_peaks	2
r_peak_primary	34.1 Å
skewness	0.543
kurtosis	-0.268
angular_range	— – 0.2300 Å⁻¹
current_alpha	0.0000
highest_alpha	8747000.0000
n_real_points	47
gnom_version	4.1.3
quality_criteria	AN1: 0.000; Oscil: 0.744; Stabil: 1.000; Sysdev: 1.000; Positv: 1.000; Valcen: 0.860; Smooth: 0.923

▶

4. Crystallography & Experiment

▶

5. Entities & Polymer Info (7)

Entity 1 polymer

description	Non-structural protein 10
formula_weight	14802.9 kDa
src_method	man
entity_count	1

Polymer

type	polypeptide(L)
strand_id	A
atom_count	5808

AGNATEVPANSTVLSFCAFAVDAAKAYKDYLASGGQPITNCVKMLCTHTGTGQAITVTPEANMDQESFGGASCCLYCRCHIDHPNPKGFCDLKGKYVQIPTTCANDPVGFTLKNTVCTVCGMWKGYGCSCDQLREPMLQ

Source

organism	Severe acute respiratory syndrome coronavirus 2
ncbi_taxonomy_id	2697049
host_organism	Escherichia coli

Entity 2 polymer

description	Proofreading exoribonuclease
formula_weight	59829.4 kDa
ec_number	3.1.13.-
src_method	man
entity_count	1

Polymer

type	polypeptide(L)
strand_id	B

AENVTGLFKDCSKVITGLHPTQAPTHLSVDTKFKTEGLCVDIPGIPKDMTYRRLISMMGFKMNYQVNGYPNMFITREEAIRHVRAWIGFDVEGCHATREAVGTNLPLQLGFSTGVNLVAVPTGYVDTPNNTDFSRVSAKPPPGDQFKHLIPLMYKGLPWNVVRIKIVQMLSDTLKNLSDRVVFVLWAHGFALTSMKYFVKIGPERTCCLCDRRATCFSTASDTYACWHHSIGFDYVYNPFMIDVQQWGFTGNLQSNHDLYCQVHGNAHVASCDAIMTRCLAVHECFVKRVDWTIEYPIIGDELKINAACRKVQHMVVKAALLADKFPVLHDIGNPKAIKCVPQADVEWKFYDAQPCSDKAYKIEELFYSYATHSDKFTDGVCLFWNCNVDRYPANSIVCRFDTRVLSNLNLPGCDGGSLYVNKHAFHTPAFDKSAFVNLKQLPFFYYSDSPCESHGKQVVSDIDYVPLKSATCITRCNLGGAVCRHHANEYRLYLDAYNMMISAGFSLWVYKQFDTYNLWNTFTRLQ

Source

organism	Severe acute respiratory syndrome coronavirus 2
ncbi_taxonomy_id	2697049
host_organism	Escherichia coli

Entity 3 polymer

description	T20P14-B RNA
formula_weight	12187.3 kDa
src_method	syn
entity_count	1

Polymer

type	polyribonucleotide
strand_id	C

GGGAACGGGAUUUUAAUAGCUUCGGCUAUUAAAAUCCC

Entity 4 polymer

description	P6 RNA
formula_weight	1788.1 kDa
src_method	syn
entity_count	1

Polymer

type	polyribonucleotide
strand_id	D

UUCCCC

Entity 5 non-polymer

description	ZINC ION
formula_weight	65.4 kDa
src_method	syn
entity_count	5

Entity 6 non-polymer

description	MAGNESIUM ION
formula_weight	24.3 kDa
src_method	syn
entity_count	1

Entity 7 non-polymer

description	;[(2~{R},3~{R},4~{R},5~{R})-5-(2-azanyl-6-oxidanylidene-1~{H}-purin-9-yl)-4-fluoranyl-4-methyl-3-oxidanyl-oxolan-2-yl]methyl dihydrogen phosphate ;
formula_weight	379.2 kDa
src_method	syn
entity_count	1

▶

6. Citations (1)

▶

length_a	1.000 Å
length_b	1.000 Å
length_c	1.000 Å
angle_alpha	90.00 °
angle_beta	90.00 °
angle_gamma	90.00 °
z_pdb	—

space_group	P 1
int_tables_number	1
crystal_system	—

resolution	2.90 Å
resolution_method	—
num_particles	472266

fit	/app/data/saxs_computation/yr/9yrl/9yrl.fit
pddf	/app/data/pr_computation/yr/9yrl/9yrl.pr.out
profile	/app/data/saxs_computation/yr/9yrl/9yrl.dat

Cryo-EM structure of SARS-CoV-2 nsp10-nsp14 (E191A) in complex with T20P14-B complex, protomer A focused refinement

SAXS Profile

P(r) Distribution

1. Structure Basics

Download Data

2. SAXS Parameters (CRYSOL)

3. P(r) Analysis (GNOM)

4. Crystallography & Experiment

Unit Cell

Symmetry

EM 3D

5. Entities & Polymer Info (7)

Entity 1 polymer

Polymer

Source

Entity 2 polymer

Polymer

Source

Entity 3 polymer

Polymer

Entity 4 polymer

Polymer

Entity 5 non-polymer

Entity 6 non-polymer

Entity 7 non-polymer

6. Citations (1)

7. Files & Curves (10)

Files (7)

Curves (3)