Solution structure of 40bp long dsDNA-Sa Oligonucleotide

{
  "code": "SASDBF2",
  "status": "Published",
  "type_of_curve": "Single concentration",
  "angular_unit": "1/nm",
  "project": {
    "title": "Wing phosphorylation is a major functional determinant of the Lrs14-type biofilm and motility regulator AbfR1 in Sulfolobus acidocaldarius.",
    "publication": {
      "title": "Wing phosphorylation is a major functional determinant of the Lrs14-type biofilm and motility regulator AbfR1 in Sulfolobus acidocaldarius.",
      "author_list": "Li L, Banerjee A, Bischof LF, Maklad HR, Hoffmann L, Henche AL, Veliz F, Bildl W, Schulte U, Orell A, Essen LO, Peeters E, Albers SV",
      "journal": "Mol Microbiol",
      "doi": "10.1111/mmi.13735",
      "pmid": "28628237",
      "published_date": "2017 Sep"
    },
    "status": "released",
    "submitted_date": "2015-10-01",
    "released_date": "2017-05-23"
  },
  "pddf_data": "https://www.sasbdb.org/media/p_of_R_files/SASDBF2.out",
  "intensities_data": "https://www.sasbdb.org/media/intensities_files/SASDBF2.dat",
  "intensities_log_plot": "https://www.sasbdb.org/media/intensities_files/scattering_plots/SASDBF2_dat_img.png",
  "intensities_kratky_plot": "https://www.sasbdb.org/media/intensities_files/scattering_plots/SASDBF2_kratky_img.png",
  "pddf_plot": "https://www.sasbdb.org/media/p_of_R_files/pofr_images/SASDBF2_pofr_img.png",
  "intensities_guinier_plot": "https://www.sasbdb.org/media/intensities_files/scattering_plots/SASDBF2_guinier_img.png",
  "sascif_data": "https://www.sasbdb.org/media/sascif/sascif_files/SASDBF2.sascif",
  "experiment": {
    "instrument": {
      "detector": {
        "type": "Dectris",
        "name": "Pilatus 1M",
        "resolution": 172.0
      },
      "name": "ESRF",
      "city": "Grenoble",
      "country": "France",
      "beamline_name": "BM29",
      "beam_geometry": "",
      "type_of_source": "X-ray synchrotron",
      "point_source": null,
      "line_collimation": null,
      "sample_path_length": null,
      "line_collimation_slitlength": null,
      "line_collimation_integrationwidth": null,
      "xray_energy": null,
      "beam_profile_ah": null,
      "beam_profile_al": null
    },
    "sample": {
      "molecule": [
        {
          "long_name": "40bp long dsDNA-Sa Oligonucleotide",
          "short_name": "dsDNA-Sa Oligo",
          "sequence": "GTAGTAAGATTTAAAAAAACATACTAAGATATAAATTAAC\r\n",
          "organism": null,
          "uniprot_code": null,
          "uniprot_range_first": null,
          "uniprot_range_last": null,
          "oligomerization": "monomer",
          "molecular_type": "DNA",
          "uniprot_sequence": null,
          "mw": 24.7,
          "total_mw": 24.7,
          "number_molecules": 1,
          "complex_state": false,
          "deuteration": null,
          "molecule_source": "biological",
          "molecule_description": null
        }
      ],
      "buffer": {
        "name": "0.5 x Tris/Borate/EDTA (TBE)",
        "concentration_unit": "v/v",
        "comment": null,
        "additive": null,
        "concentration": 0.5,
        "pka": null,
        "ph": null,
        "deuteration": null
      },
      "purity_method": null,
      "name": "Solution structure of 40bp long dsDNA-Sa Oligonucleotide",
      "ext_coefficient": null,
      "contrast": null,
      "specific_vol": null,
      "dry_vol": null,
      "absorbption": null,
      "deuteration": null,
      "mixture": null
    },
    "contributor": [
      {
        "affiliation": [
          {
            "short_name": null,
            "address": "Marburg, Germany",
            "full_name": "Philipps-Universität Marburg",
            "webpage": ""
          }
        ],
        "contributor_name": "Ankan",
        "contributor_surname": "Banerjee",
        "orcid": null
      }
    ],
    "concentration_method": null,
    "concentration_unit": "mg/ml",
    "date": "2015-08-28",
    "storage_temperature": 4.0,
    "cell_temperature": 4.0,
    "exposure_time": 10.0,
    "number_of_frames": 20,
    "wavelength": 0.93,
    "sample_detector_distance": 2.43,
    "concentration_min": null,
    "concentration_max": 1.0,
    "sample_volume": null,
    "flow_rate": null,
    "s_min": 0.033,
    "s_max": 4.934,
    "total_exposure_time": null,
    "seccolumn": null
  },
  "fits": [
    {
      "models": [
        {
          "model_plot": "https://www.sasbdb.org/media/pdb_file/images/SASDBF2_fit1_model1_img.png",
          "software": "DAMMIN",
          "pdb_link": [],
          "model_title": null,
          "type_of_model": "dummy",
          "software_version": "",
          "model_data": "https://www.sasbdb.org/media/pdb_file/SASDBF2_fit1_model1.pdb",
          "model_mw": null,
          "bead_radius": 2.5,
          "log": null,
          "symmetry": "",
          "comment": "",
          "user": 72
        }
      ],
      "fit_unit": "1/A",
      "fit_plot": "https://www.sasbdb.org/media/fitting_files/scattering_plots/SASDBF2_fit1_fit_img.png",
      "software": null,
      "chi_square_value": 1.461,
      "p_value": 0.0,
      "fit_residual_plot": "SASDBF2_fit1_fitresiduals_img.png",
      "fit_data": "https://www.sasbdb.org/media/fitting_files/SASDBF2_fit1.fir",
      "fit_log": null,
      "software_version": null,
      "description": null
    }
  ],
  "estimated_volume_method": null,
  "pddf_software": "ATSAS GNOM",
  "pddf_software_version": null,
  "i0_calibration_standard": null,
  "description": null,
  "experiment_description": "X-ray synchrotron radiation scattering data from solutions of SaOligo (40bp long dsDNA) in 0.5  x TBE was collected on the BM29 beam line on the storage ring ESRF (Grenoble, France) using a 2D Photon counting Pilatus 1M pixel detector (s = 4π sin θ/λ, where 2θ is the scattering angle). A single 1 mg/mL concentration was measured. 10 successive 20 second frames were collected. The data were normalized to the intensity of the transmitted beam and radially averaged; the scattering of the solvent-blank was subtracted. The analysis was performed using the ATSAS package. The displayed model is an averaged and volume corrected dummy atom representation (DAMFILT).",
  "tags": [],
  "intensity_unit": null,
  "experimental_mw": 82.0,
  "experimental_mw_error": null,
  "guinier_i0_mw": null,
  "guinier_i0_mw_error": null,
  "porod_mw": 18.3,
  "porod_mw_error": null,
  "pddf_i0": 82.41,
  "pddf_i0_error": null,
  "guinier_i0": 82.0,
  "guinier_i0_error": null,
  "pddf_rg": 3.55,
  "pddf_rg_error": null,
  "guinier_rg": 3.56,
  "guinier_rg_error": null,
  "pddf_dmax": 12.0,
  "pddf_dmax_error": null,
  "porod_volume": null,
  "porod_volume_error": null,
  "estimated_volume": null,
  "estimated_volume_error": null,
  "guinier_point_first": 16,
  "guinier_point_last": 57,
  "pddf_point_first": null,
  "pddf_point_last": null,
  "i0_calibration_standard_data": null,
  "intensities_log_log_plot": "SASDBF2_datloglog_img.png",
  "symmetry": null,
  "last_modified": "2019-12-06T13:07:15.624532+01:00",
  "bragg_peak": []
}

{
  "code": "SASDBF2",
  "status": "success",
  "started_at": "2026-08-11T13:37:22.002490+00:00",
  "finished_at": "2026-08-11T13:37:31.377265+00:00",
  "source_last_modified": "2019-12-06T13:07:15.624532+01:00",
  "files": [
    {
      "status": "downloaded",
      "url": "https://www.sasbdb.org/rest-api/entry/summary/SASDBF2/",
      "path": "/data/saxsdb/sasbdb/entries/f2/sasdbf2/source/summary.json",
      "size": 7010,
      "sha256": "4923b81ca90c9434feb64ff52610b4048e155056c3700c02ccbf4c5bbaf66f51"
    },
    {
      "status": "downloaded",
      "url": "https://www.sasbdb.org/media/intensities_files/SASDBF2.dat",
      "path": "/data/saxsdb/sasbdb/entries/f2/sasdbf2/source/SASDBF2.dat",
      "size": 48284,
      "sha256": "3c53acaa74a51cffb91fc9a372b4d9428fd5a47f9888b9c312a5aaabc1b0551b",
      "role": "curve"
    },
    {
      "status": "downloaded",
      "url": "https://www.sasbdb.org/media/p_of_R_files/SASDBF2.out",
      "path": "/data/saxsdb/sasbdb/entries/f2/sasdbf2/source/SASDBF2.out",
      "size": 74350,
      "sha256": "a0e6459716bf7bd52bfb7d0fa1f0f17c995df3e562f9f9d3ba0463743f04f689",
      "role": "pddf"
    },
    {
      "status": "downloaded",
      "url": "https://www.sasbdb.org/media/sascif/sascif_files/SASDBF2.sascif",
      "path": "/data/saxsdb/sasbdb/entries/f2/sasdbf2/source/SASDBF2.sascif",
      "size": 190720,
      "sha256": "06585c9ded354842e88342aba49e5f2bb74d0f3dc7206448023fca523f62270a",
      "role": "sascif"
    },
    {
      "status": "downloaded",
      "url": "https://www.sasbdb.org/media/zip_directories/SASDBF2.zip",
      "path": "/data/saxsdb/sasbdb/entries/f2/sasdbf2/source/SASDBF2.zip",
      "size": 48674,
      "sha256": "bc395c0f93dfa2d7070256756cafda38992912646ed08acf68c2b5e2a9ba0219",
      "role": "full_entry_zip",
      "zip_member_count": 4,
      "zip_validation": "central_directory_readable"
    }
  ]
}