Domain 3'X of hepatitis C virus RNA at low ionic strength

{
  "code": "SASDBP7",
  "status": "Published",
  "type_of_curve": "Extrapolated to infinite dilution",
  "angular_unit": "1/A",
  "project": {
    "title": "Three-dimensional structure of the 3'X-tail of hepatitis C virus RNA in monomeric and dimeric states.",
    "publication": {
      "title": "Three-dimensional structure of the 3'X-tail of hepatitis C virus RNA in monomeric and dimeric states.",
      "author_list": "Cantero-Camacho Á, Fan L, Wang YX, Gallego J",
      "journal": "RNA",
      "doi": "10.1261/rna.060632.117",
      "pmid": "28630140",
      "published_date": "2017 Sep"
    },
    "status": "released",
    "submitted_date": "2016-11-23",
    "released_date": "2017-06-26"
  },
  "pddf_data": "https://www.sasbdb.org/media/p_of_R_files/SASDBP7.out",
  "intensities_data": "https://www.sasbdb.org/media/intensities_files/SASDBP7.dat",
  "intensities_log_plot": "https://www.sasbdb.org/media/intensities_files/scattering_plots/SASDBP7_dat_img.png",
  "intensities_kratky_plot": "https://www.sasbdb.org/media/intensities_files/scattering_plots/SASDBP7_kratky_img.png",
  "pddf_plot": "https://www.sasbdb.org/media/p_of_R_files/pofr_images/SASDBP7_pofr_img.png",
  "intensities_guinier_plot": "https://www.sasbdb.org/media/intensities_files/scattering_plots/SASDBP7_guinier_img.png",
  "sascif_data": "https://www.sasbdb.org/media/sascif/sascif_files/SASDBP7.sascif",
  "experiment": {
    "instrument": {
      "detector": {
        "type": null,
        "name": "Pilatus 2M",
        "resolution": null
      },
      "name": "Advanced Photon Source (APS), Argonne National Laboratory",
      "city": "Lemont, IL",
      "country": "USA",
      "beamline_name": "12-ID-B SAXS/WAXS",
      "beam_geometry": null,
      "type_of_source": "X-ray synchrotron",
      "point_source": null,
      "line_collimation": null,
      "sample_path_length": null,
      "line_collimation_slitlength": null,
      "line_collimation_integrationwidth": null,
      "xray_energy": null,
      "beam_profile_ah": null,
      "beam_profile_al": null
    },
    "sample": {
      "molecule": [
        {
          "long_name": "Domain 3'X of hepatitis C virus",
          "short_name": "3'X",
          "sequence": "GGUGGCUCCAUCUUAGCCCUAGUCACGGCUAGCUGUGAAAGGUCCGUGAGCCGCUUGACUGCAGAGAGUGCUGAUACUGGCCUCUCUGCAGAUCAAGU",
          "organism": "Hepatitis C virus",
          "uniprot_code": null,
          "uniprot_range_first": null,
          "uniprot_range_last": null,
          "oligomerization": "monomer",
          "molecular_type": "RNA",
          "uniprot_sequence": null,
          "mw": 31.7,
          "total_mw": 31.7,
          "number_molecules": 1,
          "complex_state": false,
          "deuteration": null,
          "molecule_source": "biological",
          "molecule_description": null
        }
      ],
      "buffer": {
        "name": "10mM Tris 0.1 mM EDTA",
        "concentration_unit": null,
        "comment": null,
        "additive": null,
        "concentration": null,
        "pka": null,
        "ph": 7.0,
        "deuteration": null
      },
      "purity_method": null,
      "name": "Domain 3'X of hepatitis C virus RNA at low ionic strength",
      "ext_coefficient": null,
      "contrast": null,
      "specific_vol": null,
      "dry_vol": null,
      "absorbption": null,
      "deuteration": null,
      "mixture": null
    },
    "contributor": [
      {
        "affiliation": [
          {
            "short_name": null,
            "address": "Valencia, Spain",
            "full_name": "Universidad Católica de Valencia",
            "webpage": "https://www.ucv.es/"
          }
        ],
        "contributor_name": "José",
        "contributor_surname": "Gallego",
        "orcid": null
      }
    ],
    "concentration_method": null,
    "concentration_unit": null,
    "date": "2015-11-11",
    "storage_temperature": 27.0,
    "cell_temperature": 27.0,
    "exposure_time": 1.0,
    "number_of_frames": 30,
    "wavelength": 0.0886,
    "sample_detector_distance": 2.0,
    "concentration_min": 0.37,
    "concentration_max": 1.5,
    "sample_volume": null,
    "flow_rate": null,
    "s_min": 0.0,
    "s_max": 10.0,
    "total_exposure_time": null,
    "seccolumn": null
  },
  "fits": [
    {
      "models": [
        {
          "model_plot": "https://www.sasbdb.org/media/pdb_file/images/SASDBP7_fit1_model1_img.png",
          "software": "DAMMIN",
          "pdb_link": [],
          "model_title": null,
          "type_of_model": "dummy",
          "software_version": "",
          "model_data": "https://www.sasbdb.org/media/pdb_file/SASDBP7_fit1_model1.pdb",
          "model_mw": null,
          "bead_radius": 3.25,
          "log": "https://www.sasbdb.org/media/log_files/3x_UZqtgCv.log",
          "symmetry": "1",
          "comment": "",
          "user": 179
        }
      ],
      "fit_unit": "1/A",
      "fit_plot": "https://www.sasbdb.org/media/fitting_files/scattering_plots/SASDBP7_fit1_fit_img.png",
      "software": null,
      "chi_square_value": 0.26,
      "p_value": 0.033,
      "fit_residual_plot": "SASDBP7_fit1_fitresiduals_img.png",
      "fit_data": "https://www.sasbdb.org/media/fitting_files/SASDBP7_fit1.fir",
      "fit_log": null,
      "software_version": null,
      "description": null
    }
  ],
  "estimated_volume_method": null,
  "pddf_software": "ATSAS GNOM",
  "pddf_software_version": "GNOM 4.6",
  "i0_calibration_standard": null,
  "description": null,
  "experiment_description": "Synchrotron SAXS data from solutions of Domain 3'X of hepatitis C virus RNA at low ionic strength in 10mM Tris 0.1 mM EDTA, pH 7, were collected on the 12ID-B SAXS/WAXS camera on the storage ring Advanced Photon Source (APS), Argonne National Laboratory (Lemont, IL, USA) using a Pilatus 2M detector at a sample-detector distance of 2 m and at a wavelength of λ = 0.0886 nm (I(s) vs s, where s = 4π sin θ/λ, and 2θ is the scattering angle). Solute concentrations ranging between 0.4 and 1.5 mg/ml were measured at 27°C. 30 successive 1 second frames were collected. The data were normalized to the intensity of the transmitted beam and radially averaged; the scattering of the solvent-blank was subtracted and the different curves were scaled for RNA concentration. The low angle data collected at lower concentrations were extrapolated to infinite dilution and merged with the higher concentration data to yield the final composite scattering curve.",
  "tags": [],
  "intensity_unit": null,
  "experimental_mw": 36.8,
  "experimental_mw_error": null,
  "guinier_i0_mw": null,
  "guinier_i0_mw_error": null,
  "porod_mw": null,
  "porod_mw_error": null,
  "pddf_i0": 0.09238,
  "pddf_i0_error": 0.0,
  "guinier_i0": 0.092,
  "guinier_i0_error": 0.0011,
  "pddf_rg": 3.956,
  "pddf_rg_error": 0.0,
  "guinier_rg": 3.732,
  "guinier_rg_error": 0.03,
  "pddf_dmax": 14.8,
  "pddf_dmax_error": 0.06,
  "porod_volume": null,
  "porod_volume_error": null,
  "estimated_volume": null,
  "estimated_volume_error": null,
  "guinier_point_first": 4,
  "guinier_point_last": 19,
  "pddf_point_first": null,
  "pddf_point_last": null,
  "i0_calibration_standard_data": null,
  "intensities_log_log_plot": "SASDBP7_datloglog_img.png",
  "symmetry": null,
  "last_modified": "2023-03-02T16:54:16.648202+01:00",
  "bragg_peak": []
}

{
  "code": "SASDBP7",
  "status": "success",
  "started_at": "2026-08-11T16:37:49.874019+00:00",
  "finished_at": "2026-08-11T16:37:57.359686+00:00",
  "source_last_modified": "2023-03-02T16:54:16.648202+01:00",
  "files": [
    {
      "status": "downloaded",
      "url": "https://www.sasbdb.org/rest-api/entry/summary/SASDBP7/",
      "path": "/data/saxsdb/sasbdb/entries/p7/sasdbp7/source/summary.json",
      "size": 7333,
      "sha256": "654cf55f8632a2d93558ee0c517418ce641e214e0d2377bcc9a80b40bea8779c"
    },
    {
      "status": "downloaded",
      "url": "https://www.sasbdb.org/media/intensities_files/SASDBP7.dat",
      "path": "/data/saxsdb/sasbdb/entries/p7/sasdbp7/source/SASDBP7.dat",
      "size": 13798,
      "sha256": "9401a0b376da6f3c277869b6b28005bd42ce3afffb83777ed56161765066ed1a",
      "role": "curve"
    },
    {
      "status": "downloaded",
      "url": "https://www.sasbdb.org/media/p_of_R_files/SASDBP7.out",
      "path": "/data/saxsdb/sasbdb/entries/p7/sasdbp7/source/SASDBP7.out",
      "size": 17050,
      "sha256": "03e57f883aec2777f0c9df7d42cc7d00f6c58679efecf447bb3cc720fe12f701",
      "role": "pddf"
    },
    {
      "status": "downloaded",
      "url": "https://www.sasbdb.org/media/sascif/sascif_files/SASDBP7.sascif",
      "path": "/data/saxsdb/sasbdb/entries/p7/sasdbp7/source/SASDBP7.sascif",
      "size": 83593,
      "sha256": "8124edc2de9ec93d83dd795d47953e16304f56ca5847c807307dfa3f33de953c",
      "role": "sascif"
    },
    {
      "status": "downloaded",
      "url": "https://www.sasbdb.org/media/zip_directories/SASDBP7.zip",
      "path": "/data/saxsdb/sasbdb/entries/p7/sasdbp7/source/SASDBP7.zip",
      "size": 14897,
      "sha256": "9386dfc643c9e5bd09d0c1101254dbe1cb818ffdfa8a3cff28f6ff25e52b5291",
      "role": "full_entry_zip",
      "zip_member_count": 4,
      "zip_validation": "central_directory_readable"
    }
  ]
}