Aureobox dsDNA

{
  "code": "SASDBX3",
  "status": "Published",
  "type_of_curve": "Single concentration",
  "angular_unit": "1/nm",
  "project": {
    "title": "Allosteric communication between DNA-binding and light-responsive domains of diatom class I aureochromes.",
    "publication": {
      "title": "Allosteric communication between DNA-binding and light-responsive domains of diatom class I aureochromes.",
      "author_list": "Banerjee A, Herman E, Serif M, Maestre-Reyna M, Hepp S, Pokorny R, Kroth PG, Essen LO, Kottke T",
      "journal": "Nucleic Acids Res",
      "doi": "10.1093/nar/gkw420",
      "pmid": "27179025",
      "published_date": "2016 Jul 8"
    },
    "status": "released",
    "submitted_date": "2016-02-14",
    "released_date": "2016-09-19"
  },
  "pddf_data": "https://www.sasbdb.org/media/p_of_R_files/SASDBX3.out",
  "intensities_data": "https://www.sasbdb.org/media/intensities_files/SASDBX3.dat",
  "intensities_log_plot": "https://www.sasbdb.org/media/intensities_files/scattering_plots/SASDBX3_dat_img.png",
  "intensities_kratky_plot": "https://www.sasbdb.org/media/intensities_files/scattering_plots/SASDBX3_kratky_img.png",
  "pddf_plot": "https://www.sasbdb.org/media/p_of_R_files/pofr_images/SASDBX3_pofr_img.png",
  "intensities_guinier_plot": "https://www.sasbdb.org/media/intensities_files/scattering_plots/SASDBX3_guinier_img.png",
  "sascif_data": "https://www.sasbdb.org/media/sascif/sascif_files/SASDBX3.sascif",
  "experiment": {
    "instrument": {
      "detector": {
        "type": "Dectris",
        "name": "Pilatus 1M",
        "resolution": 172.0
      },
      "name": "ESRF",
      "city": "Grenoble",
      "country": "France",
      "beamline_name": "BM29",
      "beam_geometry": "",
      "type_of_source": "X-ray synchrotron",
      "point_source": null,
      "line_collimation": null,
      "sample_path_length": null,
      "line_collimation_slitlength": null,
      "line_collimation_integrationwidth": null,
      "xray_energy": null,
      "beam_profile_ah": null,
      "beam_profile_al": null
    },
    "sample": {
      "molecule": [
        {
          "long_name": "Aureobox dsDNA",
          "short_name": null,
          "sequence": "GAATTGTTGACGTGGAGTTGC\r\nGCAACTCCACGTCAACAATTC",
          "organism": "synthetic construct",
          "uniprot_code": null,
          "uniprot_range_first": null,
          "uniprot_range_last": null,
          "oligomerization": "monomer",
          "molecular_type": "DNA",
          "uniprot_sequence": null,
          "mw": 12.993,
          "total_mw": 12.993,
          "number_molecules": 1,
          "complex_state": false,
          "deuteration": null,
          "molecule_source": "biological",
          "molecule_description": null
        }
      ],
      "buffer": {
        "name": "50 mM Tris 50 mM boric acid 1 mM EDTA",
        "concentration_unit": "mM",
        "comment": null,
        "additive": "50 mM boric acid, 1 mM EDTA",
        "concentration": 50.0,
        "pka": null,
        "ph": 8.0,
        "deuteration": null
      },
      "purity_method": null,
      "name": "Aureobox dsDNA",
      "ext_coefficient": null,
      "contrast": null,
      "specific_vol": null,
      "dry_vol": null,
      "absorbption": null,
      "deuteration": null,
      "mixture": null
    },
    "contributor": [
      {
        "affiliation": [
          {
            "short_name": null,
            "address": "Marburg, Germany",
            "full_name": "Philipps-Universität Marburg",
            "webpage": ""
          }
        ],
        "contributor_name": "Ankan",
        "contributor_surname": "Banerjee",
        "orcid": null
      }
    ],
    "concentration_method": null,
    "concentration_unit": null,
    "date": "2014-11-06",
    "storage_temperature": 4.0,
    "cell_temperature": 4.0,
    "exposure_time": 20.0,
    "number_of_frames": 10,
    "wavelength": 0.93,
    "sample_detector_distance": 2.43,
    "concentration_min": null,
    "concentration_max": 1.25,
    "sample_volume": null,
    "flow_rate": null,
    "s_min": 0.036,
    "s_max": 4.975,
    "total_exposure_time": null,
    "seccolumn": null
  },
  "fits": [
    {
      "models": [
        {
          "model_plot": "https://www.sasbdb.org/media/pdb_file/images/SASDBX3_fit1_model1_img.png",
          "software": "DAMFILT",
          "pdb_link": [],
          "model_title": null,
          "type_of_model": "dummy",
          "software_version": "",
          "model_data": "https://www.sasbdb.org/media/pdb_file/SASDBX3_fit1_model1.pdb",
          "model_mw": null,
          "bead_radius": 2.0,
          "log": null,
          "symmetry": "",
          "comment": "Averaged and filtered/volume corrected model",
          "user": 72
        }
      ],
      "fit_unit": "1/A",
      "fit_plot": "https://www.sasbdb.org/media/fitting_files/scattering_plots/SASDBX3_fit1_fit_img.png",
      "software": null,
      "chi_square_value": 0.677,
      "p_value": 0.446,
      "fit_residual_plot": "SASDBX3_fit1_fitresiduals_img.png",
      "fit_data": "https://www.sasbdb.org/media/fitting_files/SASDBX3_fit1.fir",
      "fit_log": null,
      "software_version": null,
      "description": null
    }
  ],
  "estimated_volume_method": null,
  "pddf_software": "ATSAS GNOM",
  "pddf_software_version": null,
  "i0_calibration_standard": null,
  "description": null,
  "experiment_description": "X-ray synchrotron radiation scattering data from solution of Aureo box dsDNA in 0.5X TBE (50 mM Tris pH 8, 50 mM boric acid, 1 mM EDTA) buffer was collected on the BM29 camera on the storage ring ESRF (Grenoble, France) using a 2D Photon counting Pilatus 1M-W pixel detector (s = 4π sin θ/λ, where 2θ is the scattering angle). Ten successive 20 second frames were collected. The data were normalized to the intensity of the transmitted beam and radially averaged; the scattering of the solvent-blank was subtracted. Solution scattering data of Aureo box dsDNA was  performed at 1.25mg/mL concentration at 4 degrees centigrade.  The modelling analysis was performed using the ATSAS package. The displayed model is an averaged and volume corrected dummy atom representation (DAMFILT).",
  "tags": [],
  "intensity_unit": null,
  "experimental_mw": 11.9,
  "experimental_mw_error": null,
  "guinier_i0_mw": 9.3,
  "guinier_i0_mw_error": null,
  "porod_mw": 11.9,
  "porod_mw_error": null,
  "pddf_i0": 22.14,
  "pddf_i0_error": null,
  "guinier_i0": 21.45,
  "guinier_i0_error": null,
  "pddf_rg": 2.195,
  "pddf_rg_error": null,
  "guinier_rg": 2.04,
  "guinier_rg_error": null,
  "pddf_dmax": 8.6,
  "pddf_dmax_error": null,
  "porod_volume": 17.8,
  "porod_volume_error": null,
  "estimated_volume": null,
  "estimated_volume_error": null,
  "guinier_point_first": 85,
  "guinier_point_last": 126,
  "pddf_point_first": null,
  "pddf_point_last": null,
  "i0_calibration_standard_data": null,
  "intensities_log_log_plot": "SASDBX3_datloglog_img.png",
  "symmetry": null,
  "last_modified": "2019-12-06T13:07:15.624532+01:00",
  "bragg_peak": []
}

{
  "code": "SASDBX3",
  "status": "success",
  "started_at": "2026-08-11T14:09:57.205902+00:00",
  "finished_at": "2026-08-11T14:10:08.040728+00:00",
  "source_last_modified": "2019-12-06T13:07:15.624532+01:00",
  "files": [
    {
      "status": "downloaded",
      "url": "https://www.sasbdb.org/rest-api/entry/summary/SASDBX3/",
      "path": "/data/saxsdb/sasbdb/entries/x3/sasdbx3/source/summary.json",
      "size": 7058,
      "sha256": "09523b23427051a1323c8dc9745f1dd25076b3af69c62fa9e3b320fa286ea442"
    },
    {
      "status": "downloaded",
      "url": "https://www.sasbdb.org/media/intensities_files/SASDBX3.dat",
      "path": "/data/saxsdb/sasbdb/entries/x3/sasdbx3/source/SASDBX3.dat",
      "size": 47619,
      "sha256": "f4dd567c4d8b840851c91d4442dd3150f0898cd248e64abd48c3b1e6efea4683",
      "role": "curve"
    },
    {
      "status": "downloaded",
      "url": "https://www.sasbdb.org/media/p_of_R_files/SASDBX3.out",
      "path": "/data/saxsdb/sasbdb/entries/x3/sasdbx3/source/SASDBX3.out",
      "size": 61515,
      "sha256": "ab552fff1efbdc136efab0fdf34c83d07ed75b34b120095320a4c29eb43ef7b2",
      "role": "pddf"
    },
    {
      "status": "downloaded",
      "url": "https://www.sasbdb.org/media/sascif/sascif_files/SASDBX3.sascif",
      "path": "/data/saxsdb/sasbdb/entries/x3/sasdbx3/source/SASDBX3.sascif",
      "size": 188746,
      "sha256": "66ca0d75937df7cc7cd0c510d260566d3d3949007a4417b8f0fdf5071d980b05",
      "role": "sascif"
    },
    {
      "status": "downloaded",
      "url": "https://www.sasbdb.org/media/zip_directories/SASDBX3.zip",
      "path": "/data/saxsdb/sasbdb/entries/x3/sasdbx3/source/SASDBX3.zip",
      "size": 45901,
      "sha256": "79551aac8f7f0037fd6ee09e49e00a5279dba921668326acc2f136bfed5da3a8",
      "role": "full_entry_zip",
      "zip_member_count": 4,
      "zip_validation": "central_directory_readable"
    }
  ]
}