The following content comes directly from the SASBDB entry. Missing values are shown as “—”; SAXSdb does not infer undeclared units.
Every source field is expanded here, including empty values, list members and fields already shown above.
View the complete summary.json source
{
"code": "SASDCC8",
"status": "Published",
"type_of_curve": "Merged",
"angular_unit": "1/A",
"project": {
"title": "Structure and hydrodynamics of a DNA G-quadruplex with a cytosine bulge.",
"publication": {
"title": "Structure and hydrodynamics of a DNA G-quadruplex with a cytosine bulge.",
"author_list": "Meier M, Moya-Torres A, Krahn NJ, McDougall MD, Orriss GL, McRae EKS, Booy EP, McEleney K, Patel TR, McKenna SA, Stetefeld J",
"journal": "Nucleic Acids Res",
"doi": "10.1093/nar/gky307",
"pmid": "29718405",
"published_date": "2018 Jun 1"
},
"status": "released",
"submitted_date": "2017-10-10",
"released_date": "2018-05-01"
},
"pddf_data": "https://www.sasbdb.org/media/p_of_R_files/SASDCC8.out",
"intensities_data": "https://www.sasbdb.org/media/intensities_files/SASDCC8.dat",
"intensities_log_plot": "https://www.sasbdb.org/media/intensities_files/scattering_plots/SASDCC8_dat_img.png",
"intensities_kratky_plot": "https://www.sasbdb.org/media/intensities_files/scattering_plots/SASDCC8_kratky_img.png",
"pddf_plot": "https://www.sasbdb.org/media/p_of_R_files/pofr_images/SASDCC8_pofr_img.png",
"intensities_guinier_plot": "https://www.sasbdb.org/media/intensities_files/scattering_plots/SASDCC8_guinier_img.png",
"sascif_data": "https://www.sasbdb.org/media/sascif/sascif_files/SASDCC8.sascif",
"experiment": {
"instrument": {
"detector": {
"type": null,
"name": "Pilatus 2M",
"resolution": null
},
"name": "Diamond Light Source",
"city": "Didcot",
"country": "UK",
"beamline_name": "B21",
"beam_geometry": "1 x 5 mm",
"type_of_source": "X-ray synchrotron",
"point_source": null,
"line_collimation": null,
"sample_path_length": null,
"line_collimation_slitlength": null,
"line_collimation_integrationwidth": null,
"xray_energy": null,
"beam_profile_ah": null,
"beam_profile_al": null
},
"sample": {
"molecule": [
{
"long_name": "Human telomerase RNA template component, DNA counterpart, nucleotides 1-20",
"short_name": "TERC DNA",
"sequence": "GGGTTGCGGAGGGTGGGCCT",
"organism": "Homo sapiens",
"uniprot_code": null,
"uniprot_range_first": 1,
"uniprot_range_last": 20,
"oligomerization": "dimer",
"molecular_type": "DNA",
"uniprot_sequence": null,
"mw": 6.366,
"total_mw": 12.732,
"number_molecules": 2,
"complex_state": false,
"deuteration": null,
"molecule_source": "biological",
"molecule_description": null
}
],
"buffer": {
"name": "20 mM HEPES, 100 mM KCl,",
"concentration_unit": null,
"comment": null,
"additive": null,
"concentration": null,
"pka": null,
"ph": 7.5,
"deuteration": null
},
"purity_method": null,
"name": "Human TERC 1-20 DNA G-quadruplex",
"ext_coefficient": null,
"contrast": null,
"specific_vol": null,
"dry_vol": null,
"absorbption": null,
"deuteration": null,
"mixture": null
},
"contributor": [
{
"affiliation": [
{
"short_name": null,
"address": "Winnipeg, Canada",
"full_name": "University of Manitoba",
"webpage": "http://umanitoba.ca/"
}
],
"contributor_name": "Markus",
"contributor_surname": "Meier",
"orcid": null
}
],
"concentration_method": null,
"concentration_unit": null,
"date": "2017-08-02",
"storage_temperature": 4.0,
"cell_temperature": 25.0,
"exposure_time": 3.0,
"number_of_frames": 9,
"wavelength": 0.1,
"sample_detector_distance": 4.014,
"concentration_min": 2.0,
"concentration_max": 2.0,
"sample_volume": null,
"flow_rate": null,
"s_min": 0.059,
"s_max": 3.898,
"total_exposure_time": null,
"seccolumn": null
},
"fits": [
{
"models": [
{
"model_plot": "https://www.sasbdb.org/media/pdb_file/images/SASDCC8_fit1_model1_img.png",
"software": "DAMMIN",
"pdb_link": [],
"model_title": null,
"type_of_model": "dummy",
"software_version": "r9678",
"model_data": "https://www.sasbdb.org/media/pdb_file/SASDCC8_fit1_model1.pdb",
"model_mw": null,
"bead_radius": 1.25,
"log": "https://www.sasbdb.org/media/log_files/004_3_MM_p1_shape_compact-hollow_dammin_expert.log",
"symmetry": "P1",
"comment": "Fixed core calculated from 20 dammif models using compact-hollow shape assumption",
"user": 210
}
],
"fit_unit": "1/A",
"fit_plot": "https://www.sasbdb.org/media/fitting_files/scattering_plots/SASDCC8_fit1_fit_img.png",
"software": "DAMMIN",
"chi_square_value": 1.346,
"p_value": 0.003043,
"fit_residual_plot": "SASDCC8_fit1_fitresiduals_img.png",
"fit_data": "https://www.sasbdb.org/media/fitting_files/SASDCC8_fit1.fir",
"fit_log": "https://www.sasbdb.org/media/fitting_files/log_files/004_3_MM_p1_shape_compact-hollow_dammin_expert.log",
"software_version": "r9678",
"description": null
},
{
"models": [
{
"model_plot": "https://www.sasbdb.org/media/pdb_file/images/SASDCC8_fit2_model1_img.png",
"software": "DAMMIN",
"pdb_link": [],
"model_title": null,
"type_of_model": "dummy",
"software_version": "r9678",
"model_data": "https://www.sasbdb.org/media/pdb_file/SASDCC8_fit2_model1.pdb",
"model_mw": null,
"bead_radius": 1.25,
"log": "https://www.sasbdb.org/media/log_files/004_3_MM_p1_shape_compact_dammin_expert_UzSfNku.log",
"symmetry": "P1",
"comment": "Fixed core calculated from 20 dammif models using compact shape assumption.",
"user": 210
}
],
"fit_unit": "1/A",
"fit_plot": "https://www.sasbdb.org/media/fitting_files/scattering_plots/SASDCC8_fit2_fit_img.png",
"software": "DAMMIN",
"chi_square_value": 1.346,
"p_value": 0.003043,
"fit_residual_plot": "SASDCC8_fit2_fitresiduals_img.png",
"fit_data": "https://www.sasbdb.org/media/fitting_files/SASDCC8_fit2.fir",
"fit_log": "https://www.sasbdb.org/media/fitting_files/log_files/004_3_MM_p1_shape_compact_dammin_expert.log",
"software_version": "r9678",
"description": null
},
{
"models": [
{
"model_plot": "https://www.sasbdb.org/media/pdb_file/images/SASDCC8_fit3_model1_img.png",
"software": "DAMMIN",
"pdb_link": [],
"model_title": null,
"type_of_model": "dummy",
"software_version": "r9678",
"model_data": "https://www.sasbdb.org/media/pdb_file/SASDCC8_fit3_model1.pdb",
"model_mw": null,
"bead_radius": 1.25,
"log": "https://www.sasbdb.org/media/log_files/004_3_MM_p1_shape_unknown_dammin_expert.log",
"symmetry": "P1",
"comment": "Fixed core calculated from 20 dammif models using unknown shape assumption.",
"user": 210
}
],
"fit_unit": "1/A",
"fit_plot": "https://www.sasbdb.org/media/fitting_files/scattering_plots/SASDCC8_fit3_fit_img.png",
"software": "DAMMIN",
"chi_square_value": 1.346,
"p_value": 0.003043,
"fit_residual_plot": "SASDCC8_fit3_fitresiduals_img.png",
"fit_data": "https://www.sasbdb.org/media/fitting_files/SASDCC8_fit3.fir",
"fit_log": "https://www.sasbdb.org/media/fitting_files/log_files/004_3_MM_p1_shape_unknown_dammin_expert.log",
"software_version": "r9678",
"description": null
}
],
"estimated_volume_method": null,
"pddf_software": "ATSAS GNOM",
"pddf_software_version": "r9678",
"i0_calibration_standard": null,
"description": null,
"experiment_description": "Synchrotron SEC-SAXS data collection was performed at the B21 beamline of the Diamond Light Source (UK) using a Pilatus 2M detector at a sample-detector distance of 4.0 m and at a wavelength of λ = 0.1 nm (I(s) vs s, where s = 4πsinθ/λ and 2θ is the scattering angle). 50 µl purified hTERC 1-20 DNA G-quadruplex at a concentration of 5.58 mg/ml was injected into a 4.6 ml Shodex KW402.5-4F size exclusion column at a flow rate of 0.16 ml/min that was connected to the SAXS flow cell (25°C). The column diluted the sample 3-fold to approximately 2 mg/ml. Each frame was exposed for 3 seconds. 9 frames of the sample peak region were integrated, buffer subtracted and merged using the ScÅtter software package (http://www.bioisis.net/scatter). Guinier Rg, I(0) and their standard uncertainties were determined with GNOM/DATRG from ATSAS suite 2.8.2 (https://www.embl-hamburg.de/biosaxs/software.html). The Porod volume was calculated with DATPOROD from the ATSAS suite. The molecular weight derived from I(0) was calculated with SAXSMoW2 (http://saxs.ifsc.usp.br) and corrected for the appropriate mass density of the G-quadruplex DNA (1.85 g/cm³).",
"tags": [],
"intensity_unit": "arbitrary",
"experimental_mw": 14.14,
"experimental_mw_error": null,
"guinier_i0_mw": 14.14,
"guinier_i0_mw_error": null,
"porod_mw": null,
"porod_mw_error": null,
"pddf_i0": 0.0547,
"pddf_i0_error": 3e-05,
"guinier_i0": 0.05469,
"guinier_i0_error": 3e-05,
"pddf_rg": 1.419,
"pddf_rg_error": 0.002,
"guinier_rg": 1.42,
"guinier_rg_error": 0.001,
"pddf_dmax": 4.62,
"pddf_dmax_error": null,
"porod_volume": 15.1,
"porod_volume_error": null,
"estimated_volume": null,
"estimated_volume_error": null,
"guinier_point_first": 36,
"guinier_point_last": 450,
"pddf_point_first": null,
"pddf_point_last": null,
"i0_calibration_standard_data": null,
"intensities_log_log_plot": "SASDCC8_datloglog_img.png",
"symmetry": null,
"last_modified": "2019-12-06T13:07:15.624532+01:00",
"bragg_peak": []
}
