Mammalian prion protein mRNA (PrP mRNA wild type) with KCl

{
  "code": "SASDDH5",
  "status": "Published",
  "type_of_curve": "Merged",
  "angular_unit": "1/nm",
  "project": {
    "title": "Octa-repeat domain of the mammalian prion protein mRNA forms stable A-helical hairpin structure rather than G-quadruplexes.",
    "publication": {
      "title": "Octa-repeat domain of the mammalian prion protein mRNA forms stable A-helical hairpin structure rather than G-quadruplexes.",
      "author_list": "Czech A, Konarev PV, Goebel I, Svergun DI, Wills PR, Ignatova Z",
      "journal": "Sci Rep",
      "doi": "10.1038/s41598-019-39213-2",
      "pmid": "30792490",
      "published_date": "2019 Feb 21"
    },
    "status": "released",
    "submitted_date": "2018-03-29",
    "released_date": "2019-02-25"
  },
  "pddf_data": "https://www.sasbdb.org/media/p_of_R_files/SASDDH5.out",
  "intensities_data": "https://www.sasbdb.org/media/intensities_files/SASDDH5.dat",
  "intensities_log_plot": "https://www.sasbdb.org/media/intensities_files/scattering_plots/SASDDH5_dat_img.png",
  "intensities_kratky_plot": "https://www.sasbdb.org/media/intensities_files/scattering_plots/SASDDH5_kratky_img.png",
  "pddf_plot": "https://www.sasbdb.org/media/p_of_R_files/pofr_images/SASDDH5_pofr_img.png",
  "intensities_guinier_plot": "https://www.sasbdb.org/media/intensities_files/scattering_plots/SASDDH5_guinier_img.png",
  "sascif_data": "https://www.sasbdb.org/media/sascif/sascif_files/SASDDH5.sascif",
  "experiment": {
    "instrument": {
      "detector": {
        "type": null,
        "name": "Pilatus 2M",
        "resolution": null
      },
      "name": "PETRA III",
      "city": "DESY; Hamburg",
      "country": "Germany",
      "beamline_name": "EMBL P12",
      "beam_geometry": null,
      "type_of_source": "X-ray synchrotron",
      "point_source": null,
      "line_collimation": null,
      "sample_path_length": null,
      "line_collimation_slitlength": null,
      "line_collimation_integrationwidth": null,
      "xray_energy": null,
      "beam_profile_ah": null,
      "beam_profile_al": null
    },
    "sample": {
      "molecule": [
        {
          "long_name": "octo-repeat PrP mRNA",
          "short_name": "PrPmRNA",
          "sequence": "AACACUGGGGGCAGCCGAUACCCGGGGCAGGGCAGCCCUGGAGGCAACCGCUACCCACCUCAGGGCGGUGGUGGCUGGGGGCAGCCUCAUGGUGGUGGCUGGGGGCAGCCUCAUGGUGGUGGCUGGGGGCAGCCCCAUGGUGGUGGCUGGGGACAGCCUCAUGGUGGUGGCUGGGGUCAAGGAGGUGGCACCCAC\r\nCUCAGGGCGGUGGUGGCUGGGGGCC",
          "organism": "human PrP ORF",
          "uniprot_code": null,
          "uniprot_range_first": null,
          "uniprot_range_last": null,
          "oligomerization": "dimer",
          "molecular_type": "RNA",
          "uniprot_sequence": null,
          "mw": 71.89,
          "total_mw": 143.78,
          "number_molecules": 2,
          "complex_state": false,
          "deuteration": null,
          "molecule_source": "biological",
          "molecule_description": null
        }
      ],
      "buffer": {
        "name": "10 mM Tris buffer with 100 mM KCl",
        "concentration_unit": null,
        "comment": null,
        "additive": null,
        "concentration": null,
        "pka": null,
        "ph": 7.5,
        "deuteration": null
      },
      "purity_method": null,
      "name": "Mammalian prion protein mRNA (PrP mRNA wild type) with KCl",
      "ext_coefficient": null,
      "contrast": null,
      "specific_vol": null,
      "dry_vol": null,
      "absorbption": null,
      "deuteration": null,
      "mixture": null
    },
    "contributor": [
      {
        "affiliation": [
          {
            "short_name": "EMBL-Hamburg",
            "address": "Notkestraße 85, Geb. 25A, 22607 Hamburg, Deutschland, Germany",
            "full_name": "European Molecular Biology Laboratory (EMBL) - Hamburg outstation",
            "webpage": "http://www.embl-hamburg.de/index.php"
          }
        ],
        "contributor_name": "Petr",
        "contributor_surname": "Konarev",
        "orcid": null
      }
    ],
    "concentration_method": null,
    "concentration_unit": null,
    "date": "2017-06-06",
    "storage_temperature": 20.0,
    "cell_temperature": 20.0,
    "exposure_time": 0.05,
    "number_of_frames": 20,
    "wavelength": 0.124,
    "sample_detector_distance": 3.1,
    "concentration_min": 0.5,
    "concentration_max": 4.0,
    "sample_volume": null,
    "flow_rate": null,
    "s_min": 0.116,
    "s_max": 5.033,
    "total_exposure_time": null,
    "seccolumn": null
  },
  "fits": [
    {
      "models": [
        {
          "model_plot": "https://www.sasbdb.org/media/pdb_file/images/SASDDH5_fit1_model1_img.png",
          "software": "DAMFILT",
          "pdb_link": [],
          "model_title": null,
          "type_of_model": "dummy",
          "software_version": "5.0",
          "model_data": "https://www.sasbdb.org/media/pdb_file/SASDDH5_fit1_model1.pdb",
          "model_mw": null,
          "bead_radius": 7.0,
          "log": null,
          "symmetry": null,
          "comment": null,
          "user": 88
        }
      ],
      "fit_unit": "1/A",
      "fit_plot": "https://www.sasbdb.org/media/fitting_files/scattering_plots/SASDDH5_fit1_fit_img.png",
      "software": "DAMMIF",
      "chi_square_value": 1.257,
      "p_value": 0.023422,
      "fit_residual_plot": "SASDDH5_fit1_fitresiduals_img.png",
      "fit_data": "https://www.sasbdb.org/media/fitting_files/SASDDH5_fit1.fir",
      "fit_log": null,
      "software_version": null,
      "description": null
    }
  ],
  "estimated_volume_method": null,
  "pddf_software": "ATSAS GNOM",
  "pddf_software_version": "4.6",
  "i0_calibration_standard": null,
  "description": null,
  "experiment_description": "Synchrotron SAXS data from solutions of mammalian prion protein mRNA (PrP mRNA wild type) in 10 mM Tris buffer with 100 mM KCl, pH 7.5 were collected on the EMBL-P12 beam line at the PETRA III storage ring (DESY, Hamburg, Germany) using a Pilatus 2M detector at a sample-detector distance of 3.1 m and at a wavelength of λ = 0.124 nm (l(s) vs s, where s = 4πsinθ/λ, and 2θ is the scattering angle). Solute concentrations ranging between 0.5 and 4 mg/ml were measured at 20°C. 20 successive 0.050 second frames were collected. The data were normalized to the intensity of the transmitted beam and radially averaged; the scattering of the solvent-blank was subtracted. The low angle data collected at lower concentration were merged with the highest concentration high angle data to yield the final composite scattering curve.",
  "tags": [],
  "intensity_unit": "arbitrary",
  "experimental_mw": 180.0,
  "experimental_mw_error": null,
  "guinier_i0_mw": 180.0,
  "guinier_i0_mw_error": 20.0,
  "porod_mw": 220.0,
  "porod_mw_error": null,
  "pddf_i0": 123800.0,
  "pddf_i0_error": null,
  "guinier_i0": 122435.0,
  "guinier_i0_error": 1243.0,
  "pddf_rg": 9.3,
  "pddf_rg_error": 0.1,
  "guinier_rg": 8.81,
  "guinier_rg_error": 0.09,
  "pddf_dmax": 31.0,
  "pddf_dmax_error": 1.0,
  "porod_volume": 240.0,
  "porod_volume_error": null,
  "estimated_volume": null,
  "estimated_volume_error": null,
  "guinier_point_first": 1,
  "guinier_point_last": 14,
  "pddf_point_first": null,
  "pddf_point_last": null,
  "i0_calibration_standard_data": null,
  "intensities_log_log_plot": "SASDDH5_datloglog_img.png",
  "symmetry": null,
  "last_modified": "2023-06-21T07:56:39.492710+02:00",
  "bragg_peak": []
}

{
  "code": "SASDDH5",
  "status": "success",
  "started_at": "2026-08-11T14:48:20.160294+00:00",
  "finished_at": "2026-08-11T14:48:28.902962+00:00",
  "source_last_modified": "2023-06-21T07:56:39.492710+02:00",
  "files": [
    {
      "status": "downloaded",
      "url": "https://www.sasbdb.org/rest-api/entry/summary/SASDDH5/",
      "path": "/data/saxsdb/sasbdb/entries/h5/sasddh5/source/summary.json",
      "size": 7409,
      "sha256": "4bac5919d2688798d17704c4b6a31b371a2c70bbfa750681392e268388ed2a60"
    },
    {
      "status": "downloaded",
      "url": "https://www.sasbdb.org/media/intensities_files/SASDDH5.dat",
      "path": "/data/saxsdb/sasbdb/entries/h5/sasddh5/source/SASDDH5.dat",
      "size": 79075,
      "sha256": "20f7f87ef836dff3ae53563c0f5cbed147b8774a96ffc4362f960163063563c8",
      "role": "curve"
    },
    {
      "status": "downloaded",
      "url": "https://www.sasbdb.org/media/p_of_R_files/SASDDH5.out",
      "path": "/data/saxsdb/sasbdb/entries/h5/sasddh5/source/SASDDH5.out",
      "size": 35794,
      "sha256": "e82fcda227246cf1bb92f3bd8e3c1cc3692c9b375112e72771d79cc3b1f65775",
      "role": "pddf"
    },
    {
      "status": "downloaded",
      "url": "https://www.sasbdb.org/media/sascif/sascif_files/SASDDH5.sascif",
      "path": "/data/saxsdb/sasbdb/entries/h5/sasddh5/source/SASDDH5.sascif",
      "size": 170521,
      "sha256": "210036f50c952c09d8030b31fb93516d132d7a0a63eaa24aae2895f072258dd1",
      "role": "sascif"
    },
    {
      "status": "downloaded",
      "url": "https://www.sasbdb.org/media/zip_directories/SASDDH5.zip",
      "path": "/data/saxsdb/sasbdb/entries/h5/sasddh5/source/SASDDH5.zip",
      "size": 39890,
      "sha256": "562ef5656e3376190a8dafa3fa9ea84f04fb408f619084f68f4d41bd93802283",
      "role": "full_entry_zip",
      "zip_member_count": 4,
      "zip_validation": "central_directory_readable"
    }
  ]
}