SARS-CoV2 RNA pseudoknot at 4 mg/mL

{
  "code": "SASDVZ3",
  "status": "Published",
  "type_of_curve": "Single concentration",
  "angular_unit": "1/nm",
  "project": {
    "title": "Optimization of Structure‐Guided Development of Chemical Probes for the Pseudoknot RNA of the Frameshift Element in SARS‐CoV‐2",
    "publication": {
      "title": "Optimization of Structure‐Guided Development of Chemical Probes for the Pseudoknot RNA of the Frameshift Element in SARS‐CoV‐2",
      "author_list": "Ceylan B, Adam J, Toews S, Kaiser F, Dörr J, Scheppa D, Tants J, Smart A, Schoth J, Philipp S, Stirnal E, Ferner J, Richter C, Sreeramulu S, Caliskan N, Schlundt A, Weigand J, Göbel M, Wacker A, Schwalbe H",
      "journal": "Angewandte Chemie International Edition",
      "doi": "10.1002/anie.202417961",
      "pmid": null,
      "published_date": "2025 Feb 05"
    },
    "status": "released",
    "submitted_date": "2024-06-28",
    "released_date": "2025-02-06"
  },
  "pddf_data": null,
  "intensities_data": "https://www.sasbdb.org/media/intensities_files/SASDVZ3.dat",
  "intensities_log_plot": "https://www.sasbdb.org/media/intensities_files/scattering_plots/SASDVZ3_dat_img.png",
  "intensities_kratky_plot": "https://www.sasbdb.org/media/intensities_files/scattering_plots/SASDVZ3_kratky_img.png",
  "pddf_plot": null,
  "intensities_guinier_plot": "https://www.sasbdb.org/media/intensities_files/scattering_plots/SASDVZ3_guinier_img.png",
  "sascif_data": "https://www.sasbdb.org/media/sascif/sascif_files/SASDVZ3.sascif",
  "experiment": {
    "instrument": {
      "detector": {
        "type": null,
        "name": "Pilatus 6M",
        "resolution": null
      },
      "name": "PETRA III",
      "city": "DESY; Hamburg",
      "country": "Germany",
      "beamline_name": "EMBL P12",
      "beam_geometry": null,
      "type_of_source": "X-ray synchrotron",
      "point_source": null,
      "line_collimation": null,
      "sample_path_length": null,
      "line_collimation_slitlength": null,
      "line_collimation_integrationwidth": null,
      "xray_energy": null,
      "beam_profile_ah": null,
      "beam_profile_al": null
    },
    "sample": {
      "molecule": [
        {
          "long_name": "SARS-CoV2 RNA pseudoknot",
          "short_name": "SARS-CoV2 PK",
          "sequence": "GGCGGUGUAAGUGCAGCCCGUCUUACACCGUGCGGCACAGGCACUAGUACUGAUGUCGUAUACAGGGCU",
          "organism": "Severe acute respiratory syndrome coronavirus 2",
          "uniprot_code": null,
          "uniprot_range_first": null,
          "uniprot_range_last": null,
          "oligomerization": "monomer",
          "molecular_type": "RNA",
          "uniprot_sequence": "",
          "mw": 22.307,
          "total_mw": 22.307,
          "number_molecules": 1,
          "complex_state": false,
          "deuteration": null,
          "molecule_source": "biological",
          "molecule_description": ""
        }
      ],
      "buffer": {
        "name": "25 mM potassium phosphate, 50 mM KCl",
        "concentration_unit": null,
        "comment": null,
        "additive": null,
        "concentration": null,
        "pka": null,
        "ph": 6.2,
        "deuteration": null
      },
      "purity_method": null,
      "name": "SARS-CoV2 RNA pseudoknot at 4 mg/mL",
      "ext_coefficient": null,
      "contrast": null,
      "specific_vol": null,
      "dry_vol": null,
      "absorbption": null,
      "deuteration": null,
      "mixture": null
    },
    "contributor": [
      {
        "affiliation": [
          {
            "short_name": null,
            "address": null,
            "full_name": "Goethe University Frankfurt, Dept. Biosciences",
            "webpage": null
          }
        ],
        "contributor_name": "Jan-Niklas",
        "contributor_surname": "Tants",
        "orcid": "https://orcid.org/0000-0002-2455-8135"
      }
    ],
    "concentration_method": null,
    "concentration_unit": null,
    "date": "2021-11-22",
    "storage_temperature": 20.0,
    "cell_temperature": 20.0,
    "exposure_time": 0.095,
    "number_of_frames": 35,
    "wavelength": 0.123982,
    "sample_detector_distance": 3.0,
    "concentration_min": null,
    "concentration_max": 4.0,
    "sample_volume": null,
    "flow_rate": null,
    "s_min": 0.024,
    "s_max": 7.368,
    "total_exposure_time": null,
    "seccolumn": null
  },
  "fits": [],
  "estimated_volume_method": null,
  "pddf_software": null,
  "pddf_software_version": null,
  "i0_calibration_standard": null,
  "description": "Note: Possible repulsive interparticle interference present in the sample.",
  "experiment_description": "Synchrotron SAXS data from solutions of SARS-CoV2 RNA pseudoknot in 25 mM potassium phosphate, 50 mM KCl, pH 6.2 were collected on the EMBL P12 beam line at PETRA III (DESY; Hamburg, Germany) using a Pilatus 6M detector at a sample-detector distance of 3 m and at a wavelength of λ = 0.123982 nm (I(s) vs s, where s = 4πsinθ/λ, and 2θ is the scattering angle). One solute concentration of 4.00 mg/ml was measured at 20°C. 35 successive 0.095 second frames were collected. The data were normalized to the intensity of the transmitted beam and radially averaged; the scattering of the solvent-blank was subtracted.",
  "tags": [],
  "intensity_unit": "1/cm",
  "experimental_mw": 23.67,
  "experimental_mw_error": null,
  "guinier_i0_mw": null,
  "guinier_i0_mw_error": null,
  "porod_mw": null,
  "porod_mw_error": null,
  "pddf_i0": null,
  "pddf_i0_error": null,
  "guinier_i0": 0.0550028,
  "guinier_i0_error": null,
  "pddf_rg": null,
  "pddf_rg_error": null,
  "guinier_rg": 2.3,
  "guinier_rg_error": 0.004,
  "pddf_dmax": 7.9,
  "pddf_dmax_error": null,
  "porod_volume": 29.0,
  "porod_volume_error": null,
  "estimated_volume": null,
  "estimated_volume_error": null,
  "guinier_point_first": 45,
  "guinier_point_last": 190,
  "pddf_point_first": null,
  "pddf_point_last": null,
  "i0_calibration_standard_data": null,
  "intensities_log_log_plot": "SASDVZ3_datloglog_img.png",
  "symmetry": null,
  "last_modified": "2025-02-06T12:01:11.119786+01:00",
  "bragg_peak": []
}

{
  "code": "SASDVZ3",
  "status": "success",
  "started_at": "2026-08-11T14:12:03.333645+00:00",
  "finished_at": "2026-08-11T14:12:09.570158+00:00",
  "source_last_modified": "2025-02-06T12:01:11.119786+01:00",
  "files": [
    {
      "status": "downloaded",
      "url": "https://www.sasbdb.org/rest-api/entry/summary/SASDVZ3/",
      "path": "/data/saxsdb/sasbdb/entries/z3/sasdvz3/source/summary.json",
      "size": 6098,
      "sha256": "1bfa4f6e369f62e341b91d53e3e23b670ce552658160ec235f99dd390962040e"
    },
    {
      "status": "downloaded",
      "url": "https://www.sasbdb.org/media/intensities_files/SASDVZ3.dat",
      "path": "/data/saxsdb/sasbdb/entries/z3/sasdvz3/source/SASDVZ3.dat",
      "size": 121247,
      "sha256": "3ec41dcacbf724ff45898b6e80cbeee2f6c5ff18cd3c63632b4f404872647641",
      "role": "curve"
    },
    {
      "role": "pddf",
      "status": "not_listed",
      "path": "/data/saxsdb/sasbdb/entries/z3/sasdvz3/source/SASDVZ3.out"
    },
    {
      "status": "not_available",
      "url": "https://www.sasbdb.org/media/sascif/sascif_files/SASDVZ3.sascif",
      "path": "/data/saxsdb/sasbdb/entries/z3/sasdvz3/source/SASDVZ3.sascif",
      "role": "sascif"
    },
    {
      "status": "downloaded",
      "url": "https://www.sasbdb.org/media/zip_directories/SASDVZ3.zip",
      "path": "/data/saxsdb/sasbdb/entries/z3/sasdvz3/source/SASDVZ3.zip",
      "size": 33806,
      "sha256": "8d009305b9e017d5510127442fb7eabbd3c47798c3c15861c10513872e7553b0",
      "role": "full_entry_zip",
      "zip_member_count": 1,
      "zip_validation": "central_directory_readable"
    }
  ]
}