查看完整 summary.json 原文
{
"code": "SASDX54",
"status": "Published",
"type_of_curve": "Co-flow SEC-SAS",
"angular_unit": "1/A",
"project": {
"title": "Structural features within precursor microRNA-20a regulate Dicer-TRBP processing",
"publication": {
"title": "Structural features within precursor microRNA-20a regulate Dicer-TRBP processing",
"author_list": "Liu Y, Harkner C, Westwood M, Munsayac A, Keane S",
"journal": "Journal of Molecular Biology",
"doi": "10.1016/j.jmb.2025.169317",
"pmid": null,
"published_date": "2025 Jul"
},
"status": "released",
"submitted_date": "2025-04-28",
"released_date": "2025-07-03"
},
"pddf_data": "https://www.sasbdb.org/media/p_of_R_files/SASDX54.out",
"intensities_data": "https://www.sasbdb.org/media/intensities_files/SASDX54.dat",
"intensities_log_plot": "https://www.sasbdb.org/media/intensities_files/scattering_plots/SASDX54_dat_img.png",
"intensities_kratky_plot": "https://www.sasbdb.org/media/intensities_files/scattering_plots/SASDX54_kratky_img.png",
"pddf_plot": "https://www.sasbdb.org/media/p_of_R_files/pofr_images/SASDX54_pofr_img.png",
"intensities_guinier_plot": "https://www.sasbdb.org/media/intensities_files/scattering_plots/SASDX54_guinier_img.png",
"sascif_data": "https://www.sasbdb.org/media/sascif/sascif_files/SASDX54.sascif",
"experiment": {
"instrument": {
"detector": {
"type": null,
"name": "Eiger2 XE 9M",
"resolution": 72.0
},
"name": "Advanced Photon Source (APS), Argonne National Laboratory",
"city": "Lemont, IL",
"country": "USA",
"beamline_name": "BioCAT 18ID",
"beam_geometry": null,
"type_of_source": "X-ray synchrotron",
"point_source": null,
"line_collimation": null,
"sample_path_length": null,
"line_collimation_slitlength": null,
"line_collimation_integrationwidth": null,
"xray_energy": null,
"beam_profile_ah": null,
"beam_profile_al": null
},
"sample": {
"molecule": [
{
"long_name": "Precursor microRNA 20a",
"short_name": "pre-miR-20a",
"sequence": "GGUAGCACUAAAGUGCUUAUAGUGCAGGUAGUGUUUAGUUAUCUACUGCAUUAUGAGCACUUAAAGUACUGCC",
"organism": "Homo sapiens",
"uniprot_code": null,
"uniprot_range_first": null,
"uniprot_range_last": null,
"oligomerization": "monomer",
"molecular_type": "RNA",
"uniprot_sequence": "",
"mw": 23.481,
"total_mw": 23.481,
"number_molecules": 1,
"complex_state": false,
"deuteration": null,
"molecule_source": "biological",
"molecule_description": "NMR/SAXS construct of pre-miR-20a. An additional non-native G-C base pair is added at the ends of the RNA to stabilize the fold."
}
],
"buffer": {
"name": "50 mM potassium phosphate buffer, 1 mM MgCl2, 50 mM NaCl, 5 mM BME",
"concentration_unit": null,
"comment": null,
"additive": null,
"concentration": null,
"pka": null,
"ph": 7.5,
"deuteration": null
},
"purity_method": null,
"name": "Precursor microRNA 20a (pre-miR-20a)",
"ext_coefficient": null,
"contrast": null,
"specific_vol": null,
"dry_vol": null,
"absorbption": null,
"deuteration": null,
"mixture": null
},
"contributor": [
{
"affiliation": [
{
"short_name": null,
"address": null,
"full_name": "University of Michigan",
"webpage": null
}
],
"contributor_name": "Aldrex",
"contributor_surname": "Munsayac",
"orcid": "https://orcid.org/0000-0001-7268-020X"
}
],
"concentration_method": null,
"concentration_unit": null,
"date": "2022-10-08",
"storage_temperature": 4.0,
"cell_temperature": 22.0,
"exposure_time": 0.5,
"number_of_frames": 36,
"wavelength": 0.1033,
"sample_detector_distance": 3.663,
"concentration_min": null,
"concentration_max": 1.3,
"sample_volume": 260.0,
"flow_rate": 0.6,
"s_min": 0.029,
"s_max": 4.201,
"total_exposure_time": null,
"seccolumn": 3
},
"fits": [
{
"models": [
{
"model_plot": "https://www.sasbdb.org/media/pdb_file/images/SASDX54_fit1_model1_img.png",
"software": "AMBER",
"pdb_link": [],
"model_title": null,
"type_of_model": "atomic",
"software_version": null,
"model_data": "https://www.sasbdb.org/media/pdb_file/SASDX54_fit1_model1.pdb",
"model_mw": 22.54,
"bead_radius": null,
"log": null,
"symmetry": null,
"comment": null,
"user": 788
}
],
"fit_unit": "1/A",
"fit_plot": "https://www.sasbdb.org/media/fitting_files/scattering_plots/SASDX54_fit1_fitfoxs_img.png",
"software": "FoXS",
"chi_square_value": 0.878543,
"p_value": 0.811,
"fit_residual_plot": "SASDX54_fit1_fitfoxsresiduals_img.png",
"fit_data": "https://www.sasbdb.org/media/fitting_files/SASDX54_fit1.dat",
"fit_log": null,
"software_version": null,
"description": ""
},
{
"models": [
{
"model_plot": null,
"software": "DENSS",
"pdb_link": [],
"model_title": null,
"type_of_model": "density",
"software_version": null,
"model_data": "https://www.sasbdb.org/media/pdb_file/SASDX54_fit2_model1.mrc",
"model_mw": null,
"bead_radius": null,
"log": null,
"symmetry": null,
"comment": null,
"user": 788
}
],
"fit_unit": "1/A",
"fit_plot": "https://www.sasbdb.org/media/fitting_files/scattering_plots/SASDX54_fit2_fixed_fit_img.png",
"software": "DENSS",
"chi_square_value": 0.0201,
"p_value": 1.0,
"fit_residual_plot": "SASDX54_fit2_fitresiduals_img.png",
"fit_data": "https://www.sasbdb.org/media/fitting_files/SASDX54_fit2.fit",
"fit_log": null,
"software_version": null,
"description": ""
}
],
"estimated_volume_method": null,
"pddf_software": "ATSAS GNOM",
"pddf_software_version": "5.0",
"i0_calibration_standard": null,
"description": "NMR/SAXS construct of pre-miR-20a. An additional non-native G-C base pair is added at the ends of the RNA to stabilize the fold.",
"experiment_description": "Synchrotron SAXS data from solutions of precursor microRNA 20a in 50 mM potassium phosphate buffer, 1 mM MgCl2, 50 mM NaCl, 5 mM BME, pH 7.5 were collected on the BioCAT 18ID beam line at the Advanced Photon Source (APS), Argonne National Laboratory (Lemont, IL, USA) using a Eiger2 XE 9M detector at a sample-detector distance of 3.7 m and at a wavelength of λ = 0.1033 nm (I(s) vs s, where s = 4πsinθ/λ, and 2θ is the scattering angle). In-line size-exclusion chromatography (SEC) SAS was employed. The SEC parameters were as follows: A 260.00 μl sample at 1.3 mg/ml was injected at a 0.60 ml/min flow rate onto a GE Superdex 75 Increase 10/300 column at 22°C. 36 successive 0.500 second frames were collected. The data were normalized to the intensity of the transmitted beam and radially averaged; the scattering of the solvent-blank was subtracted.",
"tags": [],
"intensity_unit": "arbitrary",
"experimental_mw": 25.2,
"experimental_mw_error": null,
"guinier_i0_mw": null,
"guinier_i0_mw_error": null,
"porod_mw": null,
"porod_mw_error": null,
"pddf_i0": 0.008425,
"pddf_i0_error": null,
"guinier_i0": 0.0084136,
"guinier_i0_error": null,
"pddf_rg": 3.13,
"pddf_rg_error": null,
"guinier_rg": 3.057,
"guinier_rg_error": 0.17,
"pddf_dmax": 11.2,
"pddf_dmax_error": null,
"porod_volume": 32.0,
"porod_volume_error": null,
"estimated_volume": null,
"estimated_volume_error": null,
"guinier_point_first": 11,
"guinier_point_last": 244,
"pddf_point_first": null,
"pddf_point_last": null,
"i0_calibration_standard_data": null,
"intensities_log_log_plot": "SASDX54_datloglog_img.png",
"symmetry": null,
"last_modified": "2025-07-03T00:12:17.108560+02:00",
"bragg_peak": []
}
