SAXSdb — 1f7u

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

ARGINYL-TRNA SYNTHETASE

Saccharomyces cerevisiae

State in the Current Structure

Assembly	Oligomeric State	Construct	Mutations and Modifications	Ligands, Ions and Associated Components	Method and Experimental Conditions	Structure Quality
1	Protein–RNA Monomer Protein × 1 RNA 1 PDB declaration: dimeric（2） Consistent with all polymer counts	Chain A； UniProt 1–607	Not recorded	TRNA(ARG) × 1 SO4 SULFATE ION × 1 ARG ARGININE × 1	X-RAY DIFFRACTION X-ray crystallization conditions：VAPOR DIFFUSION, HANGING DROP；pH 7.5；277 K；2.0 M (NH4)2SO4, hexanediol, pH 7.5, VAPOR DIFFUSION, HANGING DROP at 277K	Resolution 2.20 Å R-free 0.233

Other States of the Same Protein in the Database

Each row is a biological assembly of the same UniProt protein in another PDB entry. The “Difference from current entry” column identifies evidence-level differences; no tag means the currently parsed fields agree.

Other PDB	Difference from Current Entry 1F7U	Assembly / Oligomeric State	Construct	Mutations and Modifications	Ligands, Ions and Non-polymers	Method and Experimental Conditions	Structure Quality
1BS2 YEAST ARGINYL-TRNA SYNTHETASE Deposited 1998-08-31	Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain A 1–607（607 aa）	Not recorded	ARG ARGININE × 1	X-RAY DIFFRACTION X-ray crystallization conditions pH 7；AMMONIUM SULFATE 2.45 M, 100MM TRIS-HCL, PH 7.0 AT 290K	Resolution 2.75 Å R-free 0.269
1F7V CRYSTAL STRUCTURE OF YEAST ARGINYL-TRNA SYNTHETASE COMPLEXED WITH THE TRNAARG Deposited 2000-06-28	Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–RNA Monomer；Protein × 1 PDB declaration: dimeric	Chain A 1–607（607 aa）	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 6.5；277 K；2.1 M (NH4)2SO4, hexanediol, pH 6.5, VAPOR DIFFUSION, HANGING DROP at 277K	Resolution 2.90 Å R-free 0.245

2 other PDB entries and 2 assemblies. Open the comparison page and filter oligomeric states

View Construct and Data Evidence

UniProt name	SYRC_YEAST
Isoform	—
PDB entities	2
Chains and sequence ranges	Author chain A； PDBConstruct 1–607； UniProt 1–607

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	1f7u
Deposition date deposition_date	2000-06-28
Structure title title	CRYSTAL STRUCTURE OF THE ARGINYL-TRNA SYNTHETASE COMPLEXED WITH THE TRNA(ARG) AND L-ARG
Keywords keywords	RNA-protein complex, aminoacylation, Arginyl-tRNA synthetase, ligase, LIGASE-RNA COMPLEX; LIGASE/RNA
Experimental Method method	X-RAY DIFFRACTION

▼

3. SAXS Parameters (CRYSOL theoretical calculation) 3. SAXS Parameters (CRYSOL)

Radius of gyration Rg (Guinier) rg_guinier	29.33 Å
Radius of gyration Rg (electron density) rg_electron	28.81 Å
Forward intensity I(0) i0	193099000.00
Molecular weight molecular_weight	94373.0 kDa
Excluded volume excluded_volume	111100 Å³
Envelope volume envelope_volume	143070 Å³
Hydration-shell volume shell_volume	40521 Å³
Envelope diameter envelope_diameter	98.4 Å
Shell Rg shell_rg	36.93 Å
Envelope Rg envelope_rg	28.81 Å
Shape Rg shape_rg	28.80 Å
Total Rg total_rg	29.47 Å
Total atoms total_atoms	6538
Residues n_residues	670
Spherical-harmonic order n_harmonics	20
q range q_range	— – 0.5000 Å⁻¹
Data points n_points	101
Shell type shell_type	directional
Solvent electron density solvent_density	0.3340 e/Å³
Shell contrast contrast_shell	0.0300 e/Å³
CRYSOL version crysol_version	4.1.3

▼

4. P(r) Distance Distribution (GNOM inversion) 4. P(r) Analysis (GNOM)

Maximum dimension Dmax dmax	91.0 Å
Rg (real space) rg_real	29.22 Å
Rg uncertainty (real space) rg_real_error	0.52 Å
I(0) (real space) i0_real	1.9310e+08
I(0) uncertainty (real space) i0_real_error	2.6470e+06
Rg (reciprocal space) rg_reciprocal	29.27 Å
I(0) (reciprocal space) i0_reciprocal	193100000.0000
Solution quality estimate total_estimate	0.9016
Solution quality rating solution_quality	EXCELLENT a EXCELLENT solution
P(r) peaks n_peaks	2
Primary peak position r_peak_primary	37.1 Å
Skewness Skewness skewness	0.225
Kurtosis Kurtosis kurtosis	-0.409
Angular range angular_range	— – 0.2700 Å⁻¹
Current regularization parameter α current_alpha	0.0000
Highest regularization parameter α highest_alpha	26110000.0000
Real-space data points n_real_points	55
GNOM version gnom_version	4.1.3
Quality Criteria quality_criteria	AN1: 0.000; Oscil: 0.937; Stabil: 1.000; Sysdev: 1.000; Positv: 1.000; Valcen: 0.993; Smooth: 0.915

▶

5. Crystallography and Experiment 5. Crystallography & Experiment

▶

6. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Description description	TRNA(ARG)
Molecular weight formula_weight	24573.8 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polyribonucleotide
Chain IDs strand_id	B
Atom count atom_count	7126

UUCCUCGUGGCCCAAUGGUCACGGCGUCUGGCUICGAACCAGAAGAUUCCAGGUUCAAGUCCUGGCGGGGAAGCCA

Entity 2 Entity 2 polymer

Description description	ARGINYL-TRNA SYNTHETASE
Molecular weight formula_weight	69617.9 kDa
EC 编号 ec_number	6.1.1.19
Source method src_method	man
Copy count entity_count	1

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A

MASTANMISQLKKLSIAEPAVAKDSHPDVNIVDLMRNYISQELSKISGVDSSLIFPALEWTNTMERGDLLIPIPRLRIKGANPKDLAVQWAEKFPCGDFLEKVEANGPFIQFFFNPQFLAKLVIPDILTRKEDYGSCKLVENKKVIIEFSSPNIAKPFHAGHLRSTIIGGFLANLYEKLGWEVIRMNYLGDWGKQFGLLAVGFERYGNEEALVKDPIHHLFDVYVRINKDIEEEGDSIPLEQSTNGKAREYFKRMEDGDEEALKIWKRFREFSIEKYIDTYARLNIKYDVYSGESQVSKESMLKAIDLFKEKGLTHEDKGAVLIDLTKFNKKLGKAIVQKSDGTTLYLTRDVGAAMDRYEKYHFDKMIYVIASQQDLHAAQFFEILKQMGFEWAKDLQHVNFGMVQGMSTRKGTVVFLDNILEETKEKMHEVMKKNENKYAQIEHPEEVADLVGISAVMIQDMQGKRINNYEFKWERMLSFEGDTGPYLQYAHSRLRSVERNASGITQEKWINADFSLLKEPAAKLLIRLLGQYPDVLRNAIKTHEPTTVVTYLFKLTHQVSSCYDVLWVAGQTEELATARLALYGAARQVLYNGMRLLGLTPVERM

来源 Source

来源生物 organism	Saccharomyces cerevisiae
通用名 common_name	;baker's yeast ;
NCBI Class编号 ncbi_taxonomy_id	4932
宿主生物 host_organism	Escherichia coli

Entity 3 Entity 3 non-polymer

Description description	SULFATE ION
Molecular weight formula_weight	96.1 kDa
Source method src_method	syn
Copy count entity_count	1

Entity 4 Entity 4 non-polymer

Description description	ARGININE
Molecular weight formula_weight	175.2 kDa
Source method src_method	syn
Copy count entity_count	1

Entity 5 Entity 5 water

Description description	water
Molecular weight formula_weight	18.0 kDa
Source method src_method	nat
Copy count entity_count	588

▼

7. Fold Classification (SCOP + CATH) 6 domains

SCOP 2.08 (3 domains)

Domain ID domain_id	d1f7ua1
Class class	a — All alpha proteins
Fold Fold fold	a.27 — Anticodon-binding domain of a subclass of class I aminoacyl-tRNA synthetases
Superfamily Superfamily superfamily	a.27.1 — Anticodon-binding domain of a subclass of class I aminoacyl-tRNA synthetases
Family Family family	a.27.1.1 — Anticodon-binding domain of a subclass of class I aminoacyl-tRNA synthetases

Domain ID domain_id	d1f7ua2
Class class	c — Alpha and beta proteins (a/b)
Fold Fold fold	c.26 — Adenine nucleotide alpha hydrolase-like
Superfamily Superfamily superfamily	c.26.1 — Nucleotidylyl transferase
Family Family family	c.26.1.1 — Class I aminoacyl-tRNA synthetases (RS), catalytic domain

Domain ID domain_id	d1f7ua3
Class class	d — Alpha and beta proteins (a+b)
Fold Fold fold	d.67 — RRF/tRNA synthetase additional domain-like
Superfamily Superfamily superfamily	d.67.2 — Arginyl-tRNA synthetase (ArgRS), N-terminal 'additional' domain
Family Family family	d.67.2.1 — Arginyl-tRNA synthetase (ArgRS), N-terminal 'additional' domain

CATH v4.4 (3 domains)

Domain ID domain_id	1f7uA01
Class class	3 — Alpha Beta
Architecture architecture	40 — 3-Layer(aba) Sandwich
Topology topology	50 — Rossmann fold
Homologous superfamily homologous superfamily	620 — HUPs

Domain ID domain_id	1f7uA02
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	730 — Isoleucyl-tRNA Synthetase; Domain 1
Homologous superfamily homologous superfamily	10 — Isoleucyl-tRNA Synthetase; Domain 1

Domain ID domain_id	1f7uA03
Class class	3 — Alpha Beta
Architecture architecture	30 — 2-Layer Sandwich
Topology topology	1360 — Gyrase A; domain 2
Homologous superfamily homologous superfamily	70 — Arginyl tRNA synthetase N-terminal domain

▶

8. Citations (2)

▶

Unit-cell length a length_a	129.646 Å
Unit-cell length b length_b	107.472 Å
Unit-cell length c length_c	71.379 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	90.00 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	4

Space group space_group	P 21 21 2
Space-group number int_tables_number	18
Crystal system crystal_system	—

Resolution resolution	2.200 Å
Low-resolution limit resolution_low	14.980 Å
R factor r_factor	—
R_work r_work	0.1900
R_free r_free	0.2330

fit	/app/data/saxs_computation/f7/1f7u/1f7u.fit
pddf	/app/data/pr_computation/f7/1f7u/1f7u.pr.out
profile	/app/data/saxs_computation/f7/1f7u/1f7u.dat

CRYSTAL STRUCTURE OF THE ARGINYL-TRNA SYNTHETASE COMPLEXED WITH THE TRNA(ARG) AND L-ARG

1. Protein Identity and Related Structures Protein Identity & Related Structures

ARGINYL-TRNA SYNTHETASE

State in the Current Structure

Other States of the Same Protein in the Database

SAXS scattering curve SAXS Profile

P(r) Distance Distribution P(r) Distribution

2. Structure Basics 2. Structure Basics

3. SAXS Parameters (CRYSOL theoretical calculation) 3. SAXS Parameters (CRYSOL)

4. P(r) Distance Distribution (GNOM inversion) 4. P(r) Analysis (GNOM)

5. Crystallography and Experiment 5. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

6. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Polymer Polymer

Entity 2 Entity 2 polymer

Polymer Polymer

来源 Source

Entity 3 Entity 3 non-polymer

Entity 4 Entity 4 non-polymer

Entity 5 Entity 5 water

7. Fold Classification (SCOP + CATH) 6 domains

SCOP 2.08 (3 domains)

CATH v4.4 (3 domains)

8. Citations (2)

9. Files and Curves (10)

Files (7)

Curves (3)