1flo

FLP Recombinase-Holliday Junction Complex I

Method: X-RAY DIFFRACTION

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

FLP RECOMBINASE

Saccharomyces cerevisiae

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–DNA	Homooligomer	Protein 4 DNA 8	SYMMETRIZED FRT DNA SITES × 4 SYMMETRIZED FRT DNA SITES × 4 PHOSPHONIC ACID × 4 water × 9	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	FLP_YEAST
Isoform	—
PDB entities	3
Chains and sequence ranges	Author chain A； PDBConstruct 1–422； UniProt 2–423 Author chain B； PDBConstruct 1–422； UniProt 2–423 Author chain C； PDBConstruct 1–422； UniProt 2–423 Author chain D； PDBConstruct 1–422； UniProt 2–423

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	1flo
Deposition date deposition_date	2000-08-14
Structure title title	FLP Recombinase-Holliday Junction Complex I
Keywords keywords	Tyrosine recombinase, protein-DNA complex, Holliday-junction, domain-swapping, ligase, lyase-DNA COMPLEX; ligase, lyase/DNA
Experimental Method method	X-RAY DIFFRACTION

▼

3. Official assembly/model SAXS Official SAXS Profiles

This page reads only the latest assembly calculations. Every curve maps to an explicit PDB entry, official biological assembly and coordinate model.

1flo__assembly_1__model_1

Assembly 1 · Model 1 · CRYSOL 4.1.3-1-20251215 (887e7ef)

Download this curve (.dat)

1flo__assembly_1__model_1 | I(q)

100 plotted points; both axes use logarithmic scales.

1flo__assembly_1__model_1 | P(r) · Pending

P(r) will be calculated and displayed separately for the same assembly/model.

Rg（Guinier）	40.79 Å
Rg (electron density)	40.20 Å
Total Rg	40.60 Å
Atom count	15871
Residues	1752
Excluded volume	276920 Å³
Maximum q	0.500 Å⁻¹

Assembly	Model	Structure unit	Oligomeric description	Status	CRYSOL	Actions
1	1	`1flo__assembly_1__model_1`	dodecameric （12）	Success	4.1.3-1-20251215 (887e7ef)	View Download

▶

4. Crystallography and Experiment 4. Crystallography & Experiment

▶

5. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Description description	SYMMETRIZED FRT DNA SITES
Molecular weight formula_weight	3916.6 kDa
Source method src_method	syn
Copy count entity_count	4

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	E,G,I,K
Atom count atom_count	16064

TAAGTTCCTATTC

Entity 2 Entity 2 polymer

Description description	SYMMETRIZED FRT DNA SITES
Molecular weight formula_weight	6165.0 kDa
Source method src_method	syn
Copy count entity_count	4

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	F,H,J,L

TTTAAAAGAATAGGAACTTC

Entity 3 Entity 3 polymer

Description description	FLP RECOMBINASE
Molecular weight formula_weight	48611.7 kDa
Source method src_method	man
Copy count entity_count	4

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A,B,C,D

PQFDILCKTPPKVLVRQFVERFERPSGEKIALCAAELTYLCWMITHNGTAIKRATFMSYNTIISNSLSFDIVNKSLQFKYKTQKATILEASLKKLIPAWEFTIIPYYGQKHQSDITDIVSSLQLQFESSEEADKGNSHSKKMLKALLSEGESIWEITEKILNSFEYTSRFTKTKTLYQFLFLATFINCGRFSDIKNVDPKSFKLVQNKYLGVIIQCLVTETKTSVSRHIYFFSARGRIDPLVYLDEFLRNSEPVLKRVNRTGNSSSNKQEYQLLKDNLVRSYNKALKKNAPYSIFAIKNGPKSHIGRHLMTSFLSMKGLTELTNVVGNWSDKRASAVARTTYTHQITAIPDHYFALVSRYYAYDPISKEMIALKDETNPIEEWQHIEQLKGSAEGSIRYPAWNGIISQEVLDYLSSYINRRI

Source Source

Source organism organism	Saccharomyces cerevisiae
Common name common_name	;baker's yeast ;
NCBI taxonomy ID ncbi_taxonomy_id	4932
Host organism host_organism	Escherichia coli

Entity 4 Entity 4 non-polymer

Description description	PHOSPHONIC ACID
Molecular weight formula_weight	82.0 kDa
Source method src_method	syn
Copy count entity_count	4

Entity 5 Entity 5 water

Description description	water
Molecular weight formula_weight	18.0 kDa
Source method src_method	nat
Copy count entity_count	193

▼

6. Fold Classification (SCOP + CATH) 16 domains

SCOP 2.08 (8 domains)

Domain ID domain_id	d1floa1
Class class	a — All alpha proteins
Fold Fold fold	a.60 — SAM domain-like
Superfamily Superfamily superfamily	a.60.9 — lambda integrase-like, N-terminal domain
Family Family family	a.60.9.1 — lambda integrase-like, N-terminal domain

Domain ID domain_id	d1floa2
Class class	d — Alpha and beta proteins (a+b)
Fold Fold fold	d.163 — DNA breaking-rejoining enzymes
Superfamily Superfamily superfamily	d.163.1 — DNA breaking-rejoining enzymes
Family Family family	d.163.1.1 — Lambda integrase-like, catalytic core

Domain ID domain_id	d1flob1
Class class	a — All alpha proteins
Fold Fold fold	a.60 — SAM domain-like
Superfamily Superfamily superfamily	a.60.9 — lambda integrase-like, N-terminal domain
Family Family family	a.60.9.1 — lambda integrase-like, N-terminal domain

Domain ID domain_id	d1flob2
Class class	d — Alpha and beta proteins (a+b)
Fold Fold fold	d.163 — DNA breaking-rejoining enzymes
Superfamily Superfamily superfamily	d.163.1 — DNA breaking-rejoining enzymes
Family Family family	d.163.1.1 — Lambda integrase-like, catalytic core

Domain ID domain_id	d1floc1
Class class	a — All alpha proteins
Fold Fold fold	a.60 — SAM domain-like
Superfamily Superfamily superfamily	a.60.9 — lambda integrase-like, N-terminal domain
Family Family family	a.60.9.1 — lambda integrase-like, N-terminal domain

Domain ID domain_id	d1floc2
Class class	d — Alpha and beta proteins (a+b)
Fold Fold fold	d.163 — DNA breaking-rejoining enzymes
Superfamily Superfamily superfamily	d.163.1 — DNA breaking-rejoining enzymes
Family Family family	d.163.1.1 — Lambda integrase-like, catalytic core

Domain ID domain_id	d1flod1
Class class	a — All alpha proteins
Fold Fold fold	a.60 — SAM domain-like
Superfamily Superfamily superfamily	a.60.9 — lambda integrase-like, N-terminal domain
Family Family family	a.60.9.1 — lambda integrase-like, N-terminal domain

Domain ID domain_id	d1flod2
Class class	d — Alpha and beta proteins (a+b)
Fold Fold fold	d.163 — DNA breaking-rejoining enzymes
Superfamily Superfamily superfamily	d.163.1 — DNA breaking-rejoining enzymes
Family Family family	d.163.1.1 — Lambda integrase-like, catalytic core

CATH v4.4 (8 domains)

Domain ID domain_id	1floA01
Class class	3 — Alpha Beta
Architecture architecture	30 — 2-Layer Sandwich
Topology topology	300 — GMP Synthetase; Chain A, domain 3
Homologous superfamily homologous superfamily	80 — FLP Recombinase, lambda integrase-like, N-terminal domain (domain 1)

Domain ID domain_id	1floA02
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	443 — hpI Integrase; Chain A
Homologous superfamily homologous superfamily	10 — Intergrase catalytic core

Domain ID domain_id	1floB01
Class class	3 — Alpha Beta
Architecture architecture	30 — 2-Layer Sandwich
Topology topology	300 — GMP Synthetase; Chain A, domain 3
Homologous superfamily homologous superfamily	80 — FLP Recombinase, lambda integrase-like, N-terminal domain (domain 1)

Domain ID domain_id	1floB02
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	443 — hpI Integrase; Chain A
Homologous superfamily homologous superfamily	10 — Intergrase catalytic core

Domain ID domain_id	1floC01
Class class	3 — Alpha Beta
Architecture architecture	30 — 2-Layer Sandwich
Topology topology	300 — GMP Synthetase; Chain A, domain 3
Homologous superfamily homologous superfamily	80 — FLP Recombinase, lambda integrase-like, N-terminal domain (domain 1)

Domain ID domain_id	1floC02
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	443 — hpI Integrase; Chain A
Homologous superfamily homologous superfamily	10 — Intergrase catalytic core

Domain ID domain_id	1floD01
Class class	3 — Alpha Beta
Architecture architecture	30 — 2-Layer Sandwich
Topology topology	300 — GMP Synthetase; Chain A, domain 3
Homologous superfamily homologous superfamily	80 — FLP Recombinase, lambda integrase-like, N-terminal domain (domain 1)

Domain ID domain_id	1floD02
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	443 — hpI Integrase; Chain A
Homologous superfamily homologous superfamily	10 — Intergrase catalytic core

▶

Unit-cell length a length_a	81.480 Å
Unit-cell length b length_b	180.180 Å
Unit-cell length c length_c	98.600 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	97.02 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	8

Space group space_group	P 1 21 1
Space-group number int_tables_number	4
Crystal system crystal_system	—

Resolution resolution	2.650 Å
Low-resolution limit resolution_low	15.000 Å
R factor r_factor	0.2540
R_work r_work	0.2490
R_free r_free	0.2970

FLP Recombinase-Holliday Junction Complex I

1. Protein Identity and Related Structures Protein Identity & Related Structures

FLP RECOMBINASE

State in the Current Structure

Other States of the Same Protein in the Database

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

1flo__assembly_1__model_1

1flo__assembly_1__model_1 | I(q)

1flo__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Polymer Polymer

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 polymer

Polymer Polymer

Source Source

Entity 4 Entity 4 non-polymer

Entity 5 Entity 5 water

6. Fold Classification (SCOP + CATH) 16 domains

SCOP 2.08 (8 domains)

CATH v4.4 (8 domains)

7. Citations (1)

FLP Recombinase-Holliday Junction Complex I

1. Protein Identity and Related Structures Protein Identity & Related Structures

FLP RECOMBINASE

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

1flo__assembly_1__model_1

1flo__assembly_1__model_1 | I(q)

1flo__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Polymer Polymer

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 polymer

Polymer Polymer

Source Source

Entity 4 Entity 4 non-polymer

Entity 5 Entity 5 water

6. Fold Classification (SCOP + CATH) 16 domains

SCOP 2.08 (8 domains)

CATH v4.4 (8 domains)

7. Citations (1)