1g59

GLUTAMYL-TRNA SYNTHETASE COMPLEXED WITH TRNA(GLU).

Method: X-RAY DIFFRACTION

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

GLUTAMYL-TRNA SYNTHETASE

Thermus thermophilus

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–RNA	Monomer	Protein 1 RNA 1	TRNA(GLU) × 1 water × 2	Consistent with all polymers
2	Protein–RNA	Monomer	Protein 1 RNA 1	TRNA(GLU) × 1 water × 2	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	SYE_THET8
Isoform	—
PDB entities	2
Chains and sequence ranges	Author chain A； PDBConstruct 1–468； UniProt 1–468 Author chain C； PDBConstruct 1–468； UniProt 1–468

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	1g59
Deposition date deposition_date	2000-10-31
Structure title title	GLUTAMYL-TRNA SYNTHETASE COMPLEXED WITH TRNA(GLU).
Keywords keywords	;aminoacyl-tRNA synthetase, protein-RNA complex, transfer RNA, RIKEN Structural Genomics/Proteomics Initiative, RSGI, Structural Genomics, LIGASE-RNA COMPLEX ;; LIGASE/RNA
Experimental Method method	X-RAY DIFFRACTION

▼

3. Official assembly/model SAXS Official SAXS Profiles

This page reads only the latest assembly calculations. Every curve maps to an explicit PDB entry, official biological assembly and coordinate model.

1g59__assembly_2__model_1

Assembly 2 · Model 1 · CRYSOL 4.1.3-1-20251215 (887e7ef)

Download this curve (.dat)

1g59__assembly_2__model_1 | I(q)

100 plotted points; both axes use logarithmic scales.

1g59__assembly_2__model_1 | P(r) · Pending

P(r) will be calculated and displayed separately for the same assembly/model.

Rg（Guinier）	30.74 Å
Rg (electron density)	31.21 Å
Total Rg	31.53 Å
Atom count	5410
Residues	543
Excluded volume	90631 Å³
Maximum q	0.500 Å⁻¹

Assembly	Model	Structure unit	Oligomeric description	Status	CRYSOL	Actions
1	1	`1g59__assembly_1__model_1`	dimeric （2）	Success	4.1.3-1-20251215 (887e7ef)	View Download
2	1	`1g59__assembly_2__model_1`	dimeric （2）	Success	4.1.3-1-20251215 (887e7ef)	View Download

▶

4. Crystallography and Experiment 4. Crystallography & Experiment

▶

5. Entities and Polymers Entities & Polymers (3)

Entity 1 Entity 1 polymer

Description description	TRNA(GLU)
Molecular weight formula_weight	24105.3 kDa
Source method src_method	syn
Copy count entity_count	2

Polymer Polymer

Polymer type type	polyribonucleotide
Chain IDs strand_id	B,D
Atom count atom_count	11092

GGCCCCAUCGUCUAGCGGUUAGGACGCGGCCCUCUCAAGGCCGAAACGGGGGUUCGAUUCCCCCUGGGGUCACCA

Entity 2 Entity 2 polymer

Description description	GLUTAMYL-TRNA SYNTHETASE
Molecular weight formula_weight	53979.7 kDa
EC 编号 ec_number	6.1.1.17
Source method src_method	man
Copy count entity_count	2

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A,C

MVVTRIAPSPTGDPHVGTAYIALFNYAWARRNGGRFIVRIEDTDRARYVPGAEERILAALKWLGLSYDEGPDVAAPTGPYRQSERLPLYQKYAEELLKRGWAYRAFETPEELEQIRKEKGGYDGRARNIPPEEAEERARRGEPHVIRLKVPRPGTTEVKDELRGVVVYDNQEIPDVVLLKSDGYPTYHLANVVDDHLMGVTDVIRAEEWLVSTPIHVLLYRAFGWEAPRFYHMPLLRNPDKTKISKRKSHTSLDWYKAEGFLPEALRNYLCLMGFSMPDGREIFTLEEFIQAFTWERVSLGGPVFDLEKLRWMNGKYIREVLSLEEVAERVKPFLREAGLSWESEAYLRRAVELMRPRFDTLKEFPEKARYLFTEDYPVSEKAQRKLEEGLPLLKELYPRLRAQEEWTEAALEALLRGFAAEKGVKLGQVAQPLRAALTGSLETPGLFEILALLGKERALRRLERALA

Source Source

Source organism organism	Thermus thermophilus
NCBI taxonomy ID ncbi_taxonomy_id	274
Host organism host_organism	Escherichia coli

Entity 3 Entity 3 water

Description description	water
Molecular weight formula_weight	18.0 kDa
Source method src_method	nat
Copy count entity_count	272

▼

6. Fold Classification (SCOP + CATH) 14 domains

SCOP 2.08 (4 domains)

Domain ID domain_id	d1g59a1
Class class	a — All alpha proteins
Fold Fold fold	a.97 — An anticodon-binding domain of class I aminoacyl-tRNA synthetases
Superfamily Superfamily superfamily	a.97.1 — An anticodon-binding domain of class I aminoacyl-tRNA synthetases
Family Family family	a.97.1.1 — C-terminal domain of glutamyl-tRNA synthetase (GluRS)

Domain ID domain_id	d1g59a2
Class class	c — Alpha and beta proteins (a/b)
Fold Fold fold	c.26 — Adenine nucleotide alpha hydrolase-like
Superfamily Superfamily superfamily	c.26.1 — Nucleotidylyl transferase
Family Family family	c.26.1.1 — Class I aminoacyl-tRNA synthetases (RS), catalytic domain

Domain ID domain_id	d1g59c1
Class class	a — All alpha proteins
Fold Fold fold	a.97 — An anticodon-binding domain of class I aminoacyl-tRNA synthetases
Superfamily Superfamily superfamily	a.97.1 — An anticodon-binding domain of class I aminoacyl-tRNA synthetases
Family Family family	a.97.1.1 — C-terminal domain of glutamyl-tRNA synthetase (GluRS)

Domain ID domain_id	d1g59c2
Class class	c — Alpha and beta proteins (a/b)
Fold Fold fold	c.26 — Adenine nucleotide alpha hydrolase-like
Superfamily Superfamily superfamily	c.26.1 — Nucleotidylyl transferase
Family Family family	c.26.1.1 — Class I aminoacyl-tRNA synthetases (RS), catalytic domain

CATH v4.4 (10 domains)

Domain ID domain_id	1g59A01
Class class	3 — Alpha Beta
Architecture architecture	40 — 3-Layer(aba) Sandwich
Topology topology	50 — Rossmann fold
Homologous superfamily homologous superfamily	620 — HUPs

Domain ID domain_id	1g59A02
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	1160 — Glutamyl-tRNA Synthetase; domain 2
Homologous superfamily homologous superfamily	10 — Glutamyl-trna Synthetase; Domain 2

Domain ID domain_id	1g59A03
Class class	3 — Alpha Beta
Architecture architecture	90 — Alpha-Beta Complex
Topology topology	800 — Glutamyl-tRNA Synthetase; domain 3
Homologous superfamily homologous superfamily	10 — Glutamyl-tRNA Synthetase; Domain 3

Domain ID domain_id	1g59A04
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	8 — Helicase, Ruva Protein; domain 3
Homologous superfamily homologous superfamily	70 — Glutamate-tRNA synthetase, class I, anticodon-binding domain 1

Domain ID domain_id	1g59A05
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	10 — Arc Repressor Mutant, subunit A
Homologous superfamily homologous superfamily	350 —

Domain ID domain_id	1g59C01
Class class	3 — Alpha Beta
Architecture architecture	40 — 3-Layer(aba) Sandwich
Topology topology	50 — Rossmann fold
Homologous superfamily homologous superfamily	620 — HUPs

Domain ID domain_id	1g59C02
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	1160 — Glutamyl-tRNA Synthetase; domain 2
Homologous superfamily homologous superfamily	10 — Glutamyl-trna Synthetase; Domain 2

Domain ID domain_id	1g59C03
Class class	3 — Alpha Beta
Architecture architecture	90 — Alpha-Beta Complex
Topology topology	800 — Glutamyl-tRNA Synthetase; domain 3
Homologous superfamily homologous superfamily	10 — Glutamyl-tRNA Synthetase; Domain 3

Domain ID domain_id	1g59C04
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	8 — Helicase, Ruva Protein; domain 3
Homologous superfamily homologous superfamily	70 — Glutamate-tRNA synthetase, class I, anticodon-binding domain 1

Domain ID domain_id	1g59C05
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	10 — Arc Repressor Mutant, subunit A
Homologous superfamily homologous superfamily	350 —

▶

Unit-cell length a length_a	109.980 Å
Unit-cell length b length_b	218.670 Å
Unit-cell length c length_c	134.670 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	90.00 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	16

Space group space_group	C 2 2 21
Space-group number int_tables_number	20
Crystal system crystal_system	—

Resolution resolution	2.400 Å
Low-resolution limit resolution_low	30.000 Å
R factor r_factor	0.2190
R_work r_work	0.2180
R_free r_free	0.2980

GLUTAMYL-TRNA SYNTHETASE COMPLEXED WITH TRNA(GLU).

1. Protein Identity and Related Structures Protein Identity & Related Structures

GLUTAMYL-TRNA SYNTHETASE

State in the Current Structure

Other States of the Same Protein in the Database

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

1g59__assembly_2__model_1

1g59__assembly_2__model_1 | I(q)

1g59__assembly_2__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (3)

Entity 1 Entity 1 polymer

Polymer Polymer

Entity 2 Entity 2 polymer

Polymer Polymer

Source Source

Entity 3 Entity 3 water

6. Fold Classification (SCOP + CATH) 14 domains

SCOP 2.08 (4 domains)

CATH v4.4 (10 domains)

7. Citations (1)

GLUTAMYL-TRNA SYNTHETASE COMPLEXED WITH TRNA(GLU).

1. Protein Identity and Related Structures Protein Identity & Related Structures

GLUTAMYL-TRNA SYNTHETASE

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

1g59__assembly_2__model_1

1g59__assembly_2__model_1 | I(q)

1g59__assembly_2__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (3)

Entity 1 Entity 1 polymer

Polymer Polymer

Entity 2 Entity 2 polymer

Polymer Polymer

Source Source

Entity 3 Entity 3 water

6. Fold Classification (SCOP + CATH) 14 domains

SCOP 2.08 (4 domains)

CATH v4.4 (10 domains)

7. Citations (1)