2cv0

Glutamyl-tRNA synthetase from Thermus thermophilus in complex with tRNA(Glu) and L-glutamate

Method: X-RAY DIFFRACTION

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

glutamyl-tRNA synthetase

Thermus thermophilus

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–RNA	Monomer	Protein 1 RNA 1	tRNA × 1 MAGNESIUM ION × 1 GLUTAMIC ACID × 2 water × 2	Consistent with all polymers
2	Protein–RNA	Monomer	Protein 1 RNA 1	tRNA × 1 MAGNESIUM ION × 1 water × 2	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	SYE_THET8
Isoform	—
PDB entities	2
Chains and sequence ranges	Author chain A； PDBConstruct 1–468； UniProt 1–468 Author chain B； PDBConstruct 1–468； UniProt 1–468

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	2cv0
Deposition date deposition_date	2005-05-31
Structure title title	Glutamyl-tRNA synthetase from Thermus thermophilus in complex with tRNA(Glu) and L-glutamate
Keywords keywords	;ligase, RNA, Structural Genomics, NPPSFA, National Project on Protein Structural and Functional Analyses, RIKEN Structural Genomics/Proteomics Initiative, RSGI, ligase-RNA COMPLEX ;; ligase/RNA
Experimental Method method	X-RAY DIFFRACTION

▼

3. Official assembly/model SAXS Official SAXS Profiles

This page reads only the latest assembly calculations. Every curve maps to an explicit PDB entry, official biological assembly and coordinate model.

2cv0__assembly_1__model_1

Assembly 1 · Model 1 · CRYSOL 4.1.3-1-20251215 (887e7ef)

Download this curve (.dat)

2cv0__assembly_1__model_1 | I(q)

100 plotted points; both axes use logarithmic scales.

2cv0__assembly_1__model_1 | P(r) · Pending

P(r) will be calculated and displayed separately for the same assembly/model.

Rg（Guinier）	30.95 Å
Rg (electron density)	31.40 Å
Total Rg	31.74 Å
Atom count	5432
Residues	543
Excluded volume	90951 Å³
Maximum q	0.500 Å⁻¹

Assembly	Model	Structure unit	Oligomeric description	Status	CRYSOL	Actions
1	1	`2cv0__assembly_1__model_1`	dimeric （2）	Success	4.1.3-1-20251215 (887e7ef)	View Download
2	1	`2cv0__assembly_2__model_1`	dimeric （2）	Success	4.1.3-1-20251215 (887e7ef)	View Download

▶

4. Crystallography and Experiment 4. Crystallography & Experiment

▶

5. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Description description	tRNA
Molecular weight formula_weight	24105.3 kDa
Source method src_method	syn
Copy count entity_count	2

Polymer Polymer

Polymer type type	polyribonucleotide
Chain IDs strand_id	C,D
Atom count atom_count	11125

GGCCCCAUCGUCUAGCGGUUAGGACGCGGCCCUCUCAAGGCCGAAACGGGGGUUCGAUUCCCCCUGGGGUCACCA

Entity 2 Entity 2 polymer

Description description	glutamyl-tRNA synthetase
Molecular weight formula_weight	53988.7 kDa
EC 编号 ec_number	6.1.1.17
Source method src_method	man
Copy count entity_count	2

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A,B

MVVTRIAPSPTGDPHVGTAYIALFNYAWARRNGGRFIVRIEDTDRARYVPGAEERILAALKWLGLSYDEGPDVGGPHGPYRQSERLPLYQKYAEELLKRGWAYRAFETPEELEQIRKEKGGYDGRARNIPPEEAEERARRGEPHVIRLKVPRPGTTEVKDELRGVVVYDNQEIPDVVLLKSDGYPTYHLANVVDDHLMGVTDVIRAEEWLVSTPIHVLLYRAFGWEAPRFYHMPLLRNPDKTKISKRKSHTSLDWYKAEGFLPEALRNYLCLMGFSMPDGREIFTLEEFIQAFTWERVSLGGPVFDLEKLRWMNGKYIREVLSLEEVAERVKPFLREAGLSWESEAYLRRAVELMRPRFDTLKEFPEKARYLFTEDYPVSEKAQRKLEEGLPLLKELYPRLRAQEEWTEAALEALLRGFAAEKGVKLGQVAQPLRAALTGSLETPGLFEILALLGKERALRRLERALA

Source Source

Source organism organism	Thermus thermophilus
NCBI taxonomy ID ncbi_taxonomy_id	274
Host organism host_organism	Escherichia coli BL21(DE3)

Entity 3 Entity 3 non-polymer

Description description	MAGNESIUM ION
Molecular weight formula_weight	24.3 kDa
Source method src_method	syn
Copy count entity_count	2

Entity 4 Entity 4 non-polymer

Description description	GLUTAMIC ACID
Molecular weight formula_weight	147.1 kDa
Source method src_method	syn
Copy count entity_count	2

Entity 5 Entity 5 water

Description description	water
Molecular weight formula_weight	18.0 kDa
Source method src_method	nat
Copy count entity_count	281

▼

6. Fold Classification (SCOP + CATH) 14 domains

SCOP 2.08 (4 domains)

Domain ID domain_id	d2cv0a1
Class class	a — All alpha proteins
Fold Fold fold	a.97 — An anticodon-binding domain of class I aminoacyl-tRNA synthetases
Superfamily Superfamily superfamily	a.97.1 — An anticodon-binding domain of class I aminoacyl-tRNA synthetases
Family Family family	a.97.1.1 — C-terminal domain of glutamyl-tRNA synthetase (GluRS)

Domain ID domain_id	d2cv0a2
Class class	c — Alpha and beta proteins (a/b)
Fold Fold fold	c.26 — Adenine nucleotide alpha hydrolase-like
Superfamily Superfamily superfamily	c.26.1 — Nucleotidylyl transferase
Family Family family	c.26.1.1 — Class I aminoacyl-tRNA synthetases (RS), catalytic domain

Domain ID domain_id	d2cv0b1
Class class	a — All alpha proteins
Fold Fold fold	a.97 — An anticodon-binding domain of class I aminoacyl-tRNA synthetases
Superfamily Superfamily superfamily	a.97.1 — An anticodon-binding domain of class I aminoacyl-tRNA synthetases
Family Family family	a.97.1.1 — C-terminal domain of glutamyl-tRNA synthetase (GluRS)

Domain ID domain_id	d2cv0b2
Class class	c — Alpha and beta proteins (a/b)
Fold Fold fold	c.26 — Adenine nucleotide alpha hydrolase-like
Superfamily Superfamily superfamily	c.26.1 — Nucleotidylyl transferase
Family Family family	c.26.1.1 — Class I aminoacyl-tRNA synthetases (RS), catalytic domain

CATH v4.4 (10 domains)

Domain ID domain_id	2cv0A01
Class class	3 — Alpha Beta
Architecture architecture	40 — 3-Layer(aba) Sandwich
Topology topology	50 — Rossmann fold
Homologous superfamily homologous superfamily	620 — HUPs

Domain ID domain_id	2cv0A02
Class class	3 — Alpha Beta
Architecture architecture	90 — Alpha-Beta Complex
Topology topology	800 — Glutamyl-tRNA Synthetase; domain 3
Homologous superfamily homologous superfamily	10 — Glutamyl-tRNA Synthetase; Domain 3

Domain ID domain_id	2cv0A03
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	1160 — Glutamyl-tRNA Synthetase; domain 2
Homologous superfamily homologous superfamily	10 — Glutamyl-trna Synthetase; Domain 2

Domain ID domain_id	2cv0A04
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	8 — Helicase, Ruva Protein; domain 3
Homologous superfamily homologous superfamily	70 — Glutamate-tRNA synthetase, class I, anticodon-binding domain 1

Domain ID domain_id	2cv0A05
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	10 — Arc Repressor Mutant, subunit A
Homologous superfamily homologous superfamily	350 —

Domain ID domain_id	2cv0B01
Class class	3 — Alpha Beta
Architecture architecture	40 — 3-Layer(aba) Sandwich
Topology topology	50 — Rossmann fold
Homologous superfamily homologous superfamily	620 — HUPs

Domain ID domain_id	2cv0B02
Class class	3 — Alpha Beta
Architecture architecture	90 — Alpha-Beta Complex
Topology topology	800 — Glutamyl-tRNA Synthetase; domain 3
Homologous superfamily homologous superfamily	10 — Glutamyl-tRNA Synthetase; Domain 3

Domain ID domain_id	2cv0B03
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	1160 — Glutamyl-tRNA Synthetase; domain 2
Homologous superfamily homologous superfamily	10 — Glutamyl-trna Synthetase; Domain 2

Domain ID domain_id	2cv0B04
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	8 — Helicase, Ruva Protein; domain 3
Homologous superfamily homologous superfamily	70 — Glutamate-tRNA synthetase, class I, anticodon-binding domain 1

Domain ID domain_id	2cv0B05
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	10 — Arc Repressor Mutant, subunit A
Homologous superfamily homologous superfamily	350 —

▶

Unit-cell length a length_a	110.727 Å
Unit-cell length b length_b	219.321 Å
Unit-cell length c length_c	135.400 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	90.00 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	16

Space group space_group	C 2 2 21
Space-group number int_tables_number	20
Crystal system crystal_system	—

Resolution resolution	2.400 Å
Low-resolution limit resolution_low	19.960 Å
R factor r_factor	0.2120
R_work r_work	0.2120
R_free r_free	0.2710

Glutamyl-tRNA synthetase from Thermus thermophilus in complex with tRNA(Glu) and L-glutamate

1. Protein Identity and Related Structures Protein Identity & Related Structures

glutamyl-tRNA synthetase

State in the Current Structure

Other States of the Same Protein in the Database

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

2cv0__assembly_1__model_1

2cv0__assembly_1__model_1 | I(q)

2cv0__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Polymer Polymer

Entity 2 Entity 2 polymer

Polymer Polymer

Source Source

Entity 3 Entity 3 non-polymer

Entity 4 Entity 4 non-polymer

Entity 5 Entity 5 water

6. Fold Classification (SCOP + CATH) 14 domains

SCOP 2.08 (4 domains)

CATH v4.4 (10 domains)

7. Citations (1)

Glutamyl-tRNA synthetase from Thermus thermophilus in complex with tRNA(Glu) and L-glutamate

1. Protein Identity and Related Structures Protein Identity & Related Structures

glutamyl-tRNA synthetase

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

2cv0__assembly_1__model_1

2cv0__assembly_1__model_1 | I(q)

2cv0__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Polymer Polymer

Entity 2 Entity 2 polymer

Polymer Polymer

Source Source

Entity 3 Entity 3 non-polymer

Entity 4 Entity 4 non-polymer

Entity 5 Entity 5 water

6. Fold Classification (SCOP + CATH) 14 domains

SCOP 2.08 (4 domains)

CATH v4.4 (10 domains)

7. Citations (1)