SAXSdb — 1il2

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

ASPARTYL-TRNA SYNTHETASE

Escherichia coli

State in the Current Structure

Assembly	Oligomeric State	Construct	Mutations and Modifications	Ligands, Ions and Associated Components	Method and Experimental Conditions	Structure Quality
1	Protein–RNA Monomer Protein × 1 RNA 1 PDB declaration: dimeric（2） Consistent with all polymer counts	Chain A； UniProt 1–590	Not recorded	ASPARTYL TRANSFER RNA × 1 SO4 SULFATE ION × 1 AMO ASPARTYL-ADENOSINE-5'-MONOPHOSPHATE × 1	X-RAY DIFFRACTION X-ray crystallization conditions：VAPOR DIFFUSION, HANGING DROP；pH 6.7；277 K；ammonium sulfate, pH 6.7, VAPOR DIFFUSION, HANGING DROP, temperature 277.0K	Resolution 2.60 Å R-free 0.257
2	Protein–RNA Monomer Protein × 1 RNA 1 PDB declaration: dimeric（2） Consistent with all polymer counts	Chain B； UniProt 1–590	Not recorded	ASPARTYL TRANSFER RNA × 1 SO4 SULFATE ION × 1 AMO ASPARTYL-ADENOSINE-5'-MONOPHOSPHATE × 1	X-RAY DIFFRACTION X-ray crystallization conditions：VAPOR DIFFUSION, HANGING DROP；pH 6.7；277 K；ammonium sulfate, pH 6.7, VAPOR DIFFUSION, HANGING DROP, temperature 277.0K	Resolution 2.60 Å R-free 0.257

Other States of the Same Protein in the Database

Each row is a biological assembly of the same UniProt protein in another PDB entry. The “Difference from current entry” column identifies evidence-level differences; no tag means the currently parsed fields agree.

Other PDB	Difference from Current Entry 1IL2	Assembly / Oligomeric State	Construct	Mutations and Modifications	Ligands, Ions and Non-polymers	Method and Experimental Conditions	Structure Quality
1C0A CRYSTAL STRUCTURE OF THE E. COLI ASPARTYL-TRNA SYNTHETASE : TRNAASP : ASPARTYL-ADENYLATE COMPLEX Deposited 1999-07-15	Different construct Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–RNA Monomer；Protein × 1 PDB declaration: dimeric	Chain A 1–585（585 aa）	Not recorded	SO4 SULFATE ION × 1 AMP ADENOSINE MONOPHOSPHATE × 1 AMO ASPARTYL-ADENOSINE-5'-MONOPHOSPHATE × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 6.8；277 K；AMMONIUM SULFATE, GLYCEROL, BIS-TRIS-PROPANE, pH 6.8, VAPOR DIFFUSION, HANGING DROP, temperature 277K	Resolution 2.40 Å R-free 0.249
1EQR CRYSTAL STRUCTURE OF FREE ASPARTYL-TRNA SYNTHETASE FROM ESCHERICHIA COLI Deposited 2000-04-06	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein homooligomer Homooligomer；Protein × 4 PDB declaration: tetrameric	Chain A 1–590（590 aa） Chain B 1–590（590 aa） Chain C 1–590（590 aa）	Not recorded	MG MAGNESIUM ION × 4	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 7；277 K；ammonium sulphate, Bis Tris propane, isopropanol, NaCl, pH 7, VAPOR DIFFUSION, HANGING DROP, temperature 277K	Resolution 2.70 Å R-free 0.269

2 other PDB entries and 2 assemblies. Open the comparison page and filter oligomeric states

View Construct and Data Evidence

UniProt name	SYD_ECOLI
Isoform	—
PDB entities	2
Chains and sequence ranges	Author chain A； PDBConstruct 1–590； UniProt 1–590 Author chain B； PDBConstruct 1–590； UniProt 1–590

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	1il2
Deposition date deposition_date	2001-05-07
Structure title title	Crystal Structure of the E. coli Aspartyl-tRNA Synthetase:Yeast tRNAasp:aspartyl-Adenylate Complex
Keywords keywords	protein-rna complex, LIGASE-RNA COMPLEX; LIGASE/RNA
Experimental Method method	X-RAY DIFFRACTION

▼

3. SAXS Parameters (CRYSOL theoretical calculation) 3. SAXS Parameters (CRYSOL)

Radius of gyration Rg (Guinier) rg_guinier	40.15 Å
Radius of gyration Rg (electron density) rg_electron	38.53 Å
Forward intensity I(0) i0	688270000.00
Molecular weight molecular_weight	178780.0 kDa
Excluded volume excluded_volume	208460 Å³
Envelope volume envelope_volume	277820 Å³
Hydration-shell volume shell_volume	60505 Å³
Envelope diameter envelope_diameter	141.0 Å
Shell Rg shell_rg	44.12 Å
Envelope Rg envelope_rg	38.43 Å
Shape Rg shape_rg	38.45 Å
Total Rg total_rg	39.00 Å
Total atoms total_atoms	12351
Residues n_residues	1299
Spherical-harmonic order n_harmonics	20
q range q_range	— – 0.5000 Å⁻¹
Data points n_points	101
Shell type shell_type	directional
Solvent electron density solvent_density	0.3340 e/Å³
Shell contrast contrast_shell	0.0300 e/Å³
CRYSOL version crysol_version	4.1.3

▼

4. P(r) Distance Distribution (GNOM inversion) 4. P(r) Analysis (GNOM)

Maximum dimension Dmax dmax	131.4 Å
Rg (real space) rg_real	40.09 Å
Rg uncertainty (real space) rg_real_error	1.37 Å
I(0) (real space) i0_real	6.8830e+08
I(0) uncertainty (real space) i0_real_error	1.1810e+07
Rg (reciprocal space) rg_reciprocal	40.15 Å
I(0) (reciprocal space) i0_reciprocal	688300000.0000
Solution quality estimate total_estimate	0.8951
Solution quality rating solution_quality	GOOD a GOOD solution
P(r) peaks n_peaks	1
Primary peak position r_peak_primary	50.6 Å
Skewness Skewness skewness	0.260
Kurtosis Kurtosis kurtosis	-0.438
Angular range angular_range	— – 0.1950 Å⁻¹
Current regularization parameter α current_alpha	0.0000
Highest regularization parameter α highest_alpha	31960000.0000
Real-space data points n_real_points	40
GNOM version gnom_version	4.1.3
Quality Criteria quality_criteria	AN1: 0.000; Oscil: 0.902; Stabil: 1.000; Sysdev: 1.000; Positv: 1.000; Valcen: 0.998; Smooth: 0.929

▶

5. Crystallography and Experiment 5. Crystallography & Experiment

▶

6. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Description description	ASPARTYL TRANSFER RNA
Molecular weight formula_weight	24181.4 kDa
Source method src_method	nat
Copy count entity_count	2

Polymer Polymer

Polymer type type	polyribonucleotide
Chain IDs strand_id	C,D
Atom count atom_count	12753

UCCGUGAUAGUUUAAUGGUCAGAAUGGGCGCUUGUCGCGUGCCAGAUCGGGGUUCAAUUCCCCGUCGCGGAGCCA

Entity 2 Entity 2 polymer

Description description	ASPARTYL-TRNA SYNTHETASE
Molecular weight formula_weight	65996.3 kDa
EC 编号 ec_number	6.1.1.12
Source method src_method	man
Copy count entity_count	2

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A,B

MRTEYCGQLRLSHVGQQVTLCGWVNRRRDLGSLIFIDMRDREGIVQVFFDPDRADALKLASELRNEFCIQVTGTVRARDEKNINRDMATGEIEVLASSLTIINRADVLPLDSNHVNTEEARLKYRYLDLRRPEMAQRLKTRAKITSLVRRFMDDHGFLDIETPMLTKATPEGARDYLVPSRVHKGKFYALPQSPQLFKQLLMMSGFDRYYQIVKCFRDEDLRADRQPEFTQIDVETSFMTAPQVREVMEALVRHLWLEVKGVDLGDFPVMTFAEAERRYGSDKPDLRNPMELTDVADLLKSVEFAVFAGPANDPKGRVAALRVPGGASLTRKQIDEYGNFVKIYGAKGLAYIKVNERAKGLEGINSPVAKFLNAEIIEDILDRTAAQDGDMIFFGADNKKIVADAMGALRLKVGKDLGLTDESKWAPLWVIDFPMFEDDGEGGLTAMHHPFTSPKDMTAAELKAAPENAVANAYDMVINGYEVGGGSVRIHNGDMQQTVFGILGINEEEQREKFGFLLDALKYGTPPHAGLAFGLDRLTMLLTGTDNIRDVIAFPKTTAAACLMTEAPSFANPTALAELSIQVVKKAENN

来源 Source

来源生物 organism	Escherichia coli
NCBI Class编号 ncbi_taxonomy_id	562
宿主生物 host_organism	Escherichia coli

Entity 3 Entity 3 non-polymer

Description description	SULFATE ION
Molecular weight formula_weight	96.1 kDa
Source method src_method	syn
Copy count entity_count	2

Entity 4 Entity 4 non-polymer

Description description	ASPARTYL-ADENOSINE-5'-MONOPHOSPHATE
Molecular weight formula_weight	462.3 kDa
Source method src_method	syn
Copy count entity_count	2

Entity 5 Entity 5 water

Description description	water
Molecular weight formula_weight	18.0 kDa
Source method src_method	nat
Copy count entity_count	402

▼

7. Fold Classification (SCOP + CATH) 12 domains

SCOP 2.08 (6 domains)

Domain ID domain_id	d1il2a1
Class class	b — All beta proteins
Fold Fold fold	b.40 — OB-fold
Superfamily Superfamily superfamily	b.40.4 — Nucleic acid-binding proteins
Family Family family	b.40.4.1 — Anticodon-binding domain

Domain ID domain_id	d1il2a2
Class class	d — Alpha and beta proteins (a+b)
Fold Fold fold	d.74 — DCoH-like
Superfamily Superfamily superfamily	d.74.4 — GAD domain-like
Family Family family	d.74.4.1 — GAD domain

Domain ID domain_id	d1il2a3
Class class	d — Alpha and beta proteins (a+b)
Fold Fold fold	d.104 — Class II aaRS and biotin synthetases
Superfamily Superfamily superfamily	d.104.1 — Class II aaRS and biotin synthetases
Family Family family	d.104.1.1 — Class II aminoacyl-tRNA synthetase (aaRS)-like, catalytic domain

Domain ID domain_id	d1il2b1
Class class	b — All beta proteins
Fold Fold fold	b.40 — OB-fold
Superfamily Superfamily superfamily	b.40.4 — Nucleic acid-binding proteins
Family Family family	b.40.4.1 — Anticodon-binding domain

Domain ID domain_id	d1il2b2
Class class	d — Alpha and beta proteins (a+b)
Fold Fold fold	d.74 — DCoH-like
Superfamily Superfamily superfamily	d.74.4 — GAD domain-like
Family Family family	d.74.4.1 — GAD domain

Domain ID domain_id	d1il2b3
Class class	d — Alpha and beta proteins (a+b)
Fold Fold fold	d.104 — Class II aaRS and biotin synthetases
Superfamily Superfamily superfamily	d.104.1 — Class II aaRS and biotin synthetases
Family Family family	d.104.1.1 — Class II aminoacyl-tRNA synthetase (aaRS)-like, catalytic domain

CATH v4.4 (6 domains)

Domain ID domain_id	1il2A01
Class class	2 — Mainly Beta
Architecture architecture	40 — Beta Barrel
Topology topology	50 — OB fold (Dihydrolipoamide Acetyltransferase, E2P)
Homologous superfamily homologous superfamily	140 — Nucleic acid-binding proteins

Domain ID domain_id	1il2A02
Class class	3 — Alpha Beta
Architecture architecture	30 — 2-Layer Sandwich
Topology topology	930 — BirA Bifunctional Protein; domain 2
Homologous superfamily homologous superfamily	10 — Bira Bifunctional Protein; Domain 2

Domain ID domain_id	1il2A03
Class class	3 — Alpha Beta
Architecture architecture	30 — 2-Layer Sandwich
Topology topology	1360 — Gyrase A; domain 2
Homologous superfamily homologous superfamily	30 — GAD-like domain

Domain ID domain_id	1il2B01
Class class	2 — Mainly Beta
Architecture architecture	40 — Beta Barrel
Topology topology	50 — OB fold (Dihydrolipoamide Acetyltransferase, E2P)
Homologous superfamily homologous superfamily	140 — Nucleic acid-binding proteins

Domain ID domain_id	1il2B02
Class class	3 — Alpha Beta
Architecture architecture	30 — 2-Layer Sandwich
Topology topology	930 — BirA Bifunctional Protein; domain 2
Homologous superfamily homologous superfamily	10 — Bira Bifunctional Protein; Domain 2

Domain ID domain_id	1il2B03
Class class	3 — Alpha Beta
Architecture architecture	30 — 2-Layer Sandwich
Topology topology	1360 — Gyrase A; domain 2
Homologous superfamily homologous superfamily	30 — GAD-like domain

▶

8. Citations (1)

▶

Unit-cell length a length_a	75.800 Å
Unit-cell length b length_b	222.800 Å
Unit-cell length c length_c	80.800 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	111.80 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	4

Space group space_group	P 1 21 1
Space-group number int_tables_number	4
Crystal system crystal_system	—

Resolution resolution	2.600 Å
Low-resolution limit resolution_low	11.500 Å
R factor r_factor	0.2040
R_work r_work	0.2040
R_free r_free	0.2570

fit	/app/data/saxs_computation/il/1il2/1il2.fit
pddf	/app/data/pr_computation/il/1il2/1il2.pr.out
profile	/app/data/saxs_computation/il/1il2/1il2.dat

Crystal Structure of the E. coli Aspartyl-tRNA Synthetase:Yeast tRNAasp:aspartyl-Adenylate Complex

1. Protein Identity and Related Structures Protein Identity & Related Structures

ASPARTYL-TRNA SYNTHETASE

State in the Current Structure

Other States of the Same Protein in the Database

SAXS scattering curve SAXS Profile

P(r) Distance Distribution P(r) Distribution

2. Structure Basics 2. Structure Basics

3. SAXS Parameters (CRYSOL theoretical calculation) 3. SAXS Parameters (CRYSOL)

4. P(r) Distance Distribution (GNOM inversion) 4. P(r) Analysis (GNOM)

5. Crystallography and Experiment 5. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

6. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Polymer Polymer

Entity 2 Entity 2 polymer

Polymer Polymer

来源 Source

Entity 3 Entity 3 non-polymer

Entity 4 Entity 4 non-polymer

Entity 5 Entity 5 water

7. Fold Classification (SCOP + CATH) 12 domains

SCOP 2.08 (6 domains)

CATH v4.4 (6 domains)

8. Citations (1)

9. Files and Curves (10)

Files (7)

Curves (3)