SAXSdb — 1je8

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

Nitrate/Nitrite Response Regulator Protein NARL

Escherichia coli

State in the Current Structure

Assembly	Oligomeric State	Construct	Mutations and Modifications	Ligands, Ions and Associated Components	Method and Experimental Conditions	Structure Quality
1	Protein–DNA Homooligomer Protein × 2 DNA 2 PDB declaration: tetrameric（4） Consistent with all polymer counts	Chain A； UniProt 147–216 Chain B； UniProt 147–216	Fragment：DNA Binding Domain (147-216) Non-standard monomer：Yes (specific site not provided by mmCIF)	5'-D(CPGPTPAPCPCPCPAPTPTPAPAPTPGPGPGPTPAPCPG)-3' × 2 SO4 SULFATE ION × 4	X-RAY DIFFRACTION X-ray crystallization conditions：VAPOR DIFFUSION, HANGING DROP；pH 7.5；298 K；ammonium sulfate, TRIS, pH 7.5, VAPOR DIFFUSION, HANGING DROP, temperature 298.0K	Resolution 2.12 Å R-free 0.273
2	Protein–DNA Homooligomer Protein × 2 DNA 2 PDB declaration: tetrameric（4） Consistent with all polymer counts	Chain E； UniProt 147–216 Chain F； UniProt 147–216	Fragment：DNA Binding Domain (147-216) Non-standard monomer：Yes (specific site not provided by mmCIF)	5'-D(CPGPTPAPCPCPCPAPTPTPAPAPTPGPGPGPTPAPCPG)-3' × 2 SO4 SULFATE ION × 4	X-RAY DIFFRACTION X-ray crystallization conditions：VAPOR DIFFUSION, HANGING DROP；pH 7.5；298 K；ammonium sulfate, TRIS, pH 7.5, VAPOR DIFFUSION, HANGING DROP, temperature 298.0K	Resolution 2.12 Å R-free 0.273

Other States of the Same Protein in the Database

Each row is a biological assembly of the same UniProt protein in another PDB entry. The “Difference from current entry” column identifies evidence-level differences; no tag means the currently parsed fields agree.

Other PDB	Difference from Current Entry 1JE8	Assembly / Oligomeric State	Construct	Mutations and Modifications	Ligands, Ions and Non-polymers	Method and Experimental Conditions	Structure Quality
1A04 THE STRUCTURE OF THE NITRATE/NITRITE RESPONSE REGULATOR PROTEIN NARL IN THE MONOCLINIC C2 CRYSTAL FORM Deposited 1997-12-08	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain A 2–216（215 aa） Fragment：RESIDUES 2 - 216 OF THE WILD TYPE NARL	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 7.6；277 K；THE PROTEIN SOLUTION CONTAINING 23.3 MG/ML OF PURIFIED NARL, 20 MM TRIS.HCL (PH=7.6), 0.5 MM MGCL2, AND 10% GLYCEROL WAS MIXED WITH AN EQUAL VOLUME OF THE RESERVOIR SOLUTION CONTAINING 0.1 M TRIS.HCL (PH=8.5), 0.2 M SODIUM ACETATE, AND 30% POLYETHYLENE GLYCOL (PEG) 4000. SITTING DROPS CONTAINING 20 ML OF MIXTURE WERE EQUILIBRATED BY VAPOR DIFFUSION AT 4 DEGREES AGAINST 20 ML OF THE RESERVOIR SOLUTION. CRYSTALS BEGAN TO APPEAR AS CLUSTERS OF PLATES AFTER 11-15 DAYS., vapor diffusion - sitting drop, temperature 277K	Resolution 2.20 Å R-free 0.267
1A04 THE STRUCTURE OF THE NITRATE/NITRITE RESPONSE REGULATOR PROTEIN NARL IN THE MONOCLINIC C2 CRYSTAL FORM Deposited 1997-12-08	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 2 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain B 2–216（215 aa） Fragment：RESIDUES 2 - 216 OF THE WILD TYPE NARL	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 7.6；277 K；THE PROTEIN SOLUTION CONTAINING 23.3 MG/ML OF PURIFIED NARL, 20 MM TRIS.HCL (PH=7.6), 0.5 MM MGCL2, AND 10% GLYCEROL WAS MIXED WITH AN EQUAL VOLUME OF THE RESERVOIR SOLUTION CONTAINING 0.1 M TRIS.HCL (PH=8.5), 0.2 M SODIUM ACETATE, AND 30% POLYETHYLENE GLYCOL (PEG) 4000. SITTING DROPS CONTAINING 20 ML OF MIXTURE WERE EQUILIBRATED BY VAPOR DIFFUSION AT 4 DEGREES AGAINST 20 ML OF THE RESERVOIR SOLUTION. CRYSTALS BEGAN TO APPEAR AS CLUSTERS OF PLATES AFTER 11-15 DAYS., vapor diffusion - sitting drop, temperature 277K	Resolution 2.20 Å R-free 0.267
1RNL THE NITRATE/NITRITE RESPONSE REGULATOR PROTEIN NARL FROM NARL Deposited 1996-04-17	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain A 2–216（215 aa） Fragment：RESIDUES 2 - 216 OF THE WILD TYPE NARL	Not recorded	PT PLATINUM (II) ION × 6 GOL GLYCEROL × 3	X-RAY DIFFRACTION mmCIF provides none of the parsed conditions	Resolution 2.40 Å R-free 0.251
1RNL THE NITRATE/NITRITE RESPONSE REGULATOR PROTEIN NARL FROM NARL Deposited 1996-04-17	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 2 Protein homooligomer Homooligomer；Protein × 4 PDB declaration: tetrameric	Chain A 2–216（215 aa） Fragment：RESIDUES 2 - 216 OF THE WILD TYPE NARL	Not recorded	PT PLATINUM (II) ION × 24 GOL GLYCEROL × 12	X-RAY DIFFRACTION mmCIF provides none of the parsed conditions	Resolution 2.40 Å R-free 0.251
1RNL THE NITRATE/NITRITE RESPONSE REGULATOR PROTEIN NARL FROM NARL Deposited 1996-04-17	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 3 Protein homooligomer Homooligomer；Protein × 2 PDB declaration: dimeric	Chain A 2–216（215 aa） Fragment：RESIDUES 2 - 216 OF THE WILD TYPE NARL	Not recorded	PT PLATINUM (II) ION × 12 GOL GLYCEROL × 6	X-RAY DIFFRACTION mmCIF provides none of the parsed conditions	Resolution 2.40 Å R-free 0.251

2 other PDB entries and 5 assemblies. Open the comparison page and filter oligomeric states

View Construct and Data Evidence

UniProt name	NARL_ECOLI
Isoform	—
PDB entities	2
Chains and sequence ranges	Author chain A； PDBConstruct 13–82； UniProt 147–216 Author chain B； PDBConstruct 13–82； UniProt 147–216 Author chain E； PDBConstruct 13–82； UniProt 147–216 Author chain F； PDBConstruct 13–82； UniProt 147–216

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	1je8
Deposition date deposition_date	2001-06-15
Structure title title	Two-Component response regulator NarL/DNA Complex: DNA Bending Found in a High Affinity Site
Keywords keywords	Protein-DNA complex, Two-Component response regulator, helix-turn-helix, DNA bending, TRANSCRIPTION-DNA COMPLEX; TRANSCRIPTION/DNA
Experimental Method method	X-RAY DIFFRACTION

▼

3. SAXS Parameters (CRYSOL theoretical calculation) 3. SAXS Parameters (CRYSOL)

Radius of gyration Rg (Guinier) rg_guinier	35.95 Å
Radius of gyration Rg (electron density) rg_electron	35.84 Å
Forward intensity I(0) i0	85333500.00
Molecular weight molecular_weight	57302.0 kDa
Excluded volume excluded_volume	64334 Å³
Envelope volume envelope_volume	91819 Å³
Hydration-shell volume shell_volume	22435 Å³
Envelope diameter envelope_diameter	124.4 Å
Shell Rg shell_rg	39.96 Å
Envelope Rg envelope_rg	35.00 Å
Shape Rg shape_rg	35.82 Å
Total Rg total_rg	36.11 Å
Total atoms total_atoms	3869
Residues n_residues	333
Spherical-harmonic order n_harmonics	20
q range q_range	— – 0.5000 Å⁻¹
Data points n_points	101
Shell type shell_type	directional
Solvent electron density solvent_density	0.3340 e/Å³
Shell contrast contrast_shell	0.0300 e/Å³
CRYSOL version crysol_version	4.1.3

▼

4. P(r) Distance Distribution (GNOM inversion) 4. P(r) Analysis (GNOM)

Maximum dimension Dmax dmax	117.9 Å
Rg (real space) rg_real	36.38 Å
Rg uncertainty (real space) rg_real_error	1.22 Å
I(0) (real space) i0_real	8.5330e+07
I(0) uncertainty (real space) i0_real_error	1.5300e+06
Rg (reciprocal space) rg_reciprocal	36.12 Å
I(0) (reciprocal space) i0_reciprocal	85310000.0000
Solution quality estimate total_estimate	0.7308
Solution quality rating solution_quality	REASONABLE a REASONABLE solution
P(r) peaks n_peaks	2
Primary peak position r_peak_primary	24.1 Å
Skewness Skewness skewness	0.414
Kurtosis Kurtosis kurtosis	-0.763
Angular range angular_range	— – 0.2200 Å⁻¹
Current regularization parameter α current_alpha	0.0000
Highest regularization parameter α highest_alpha	3704000.0000
Real-space data points n_real_points	45
GNOM version gnom_version	4.1.3
Quality Criteria quality_criteria	AN1: 0.000; Oscil: 0.577; Stabil: 1.000; Sysdev: 1.000; Positv: 1.000; Valcen: 0.318; Smooth: 0.448

▶

5. Crystallography and Experiment 5. Crystallography & Experiment

▶

6. Entities and Polymers Entities & Polymers (4)

Entity 1 Entity 1 polymer

Description description	5'-D(CPGPTPAPCPCPCPAPTPTPAPAPTPGPGPGPTPAPCPG)-3'
Molecular weight formula_weight	6134.0 kDa
Source method src_method	syn
Copy count entity_count	4

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	C,D,G,H
Atom count atom_count	4199

CGTACCCATTAATGGGTACG

Entity 2 Entity 2 polymer

Description description	Nitrate/Nitrite Response Regulator Protein NARL
Molecular weight formula_weight	9827.9 kDa
Source method src_method	man
Copy count entity_count	4

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A,B,E,F

MRGSHHHHHHGSATTERDVNQLTPRERDILKLIAQGLPNKMIARRLDITESTVKVHVKHMLKKMKLKSRVEAAVWVHQERIF

来源 Source

来源生物 organism	Escherichia coli
NCBI Class编号 ncbi_taxonomy_id	562
宿主生物 host_organism	Escherichia coli

Entity 3 Entity 3 non-polymer

Description description	SULFATE ION
Molecular weight formula_weight	96.1 kDa
Source method src_method	syn
Copy count entity_count	8

Entity 4 Entity 4 water

Description description	water
Molecular weight formula_weight	18.0 kDa
Source method src_method	nat
Copy count entity_count	330

▼

7. Fold Classification (SCOP + CATH) 8 domains

SCOP 2.08 (4 domains)

Domain ID domain_id	d1je8a_
Class class	a — All alpha proteins
Fold Fold fold	a.4 — DNA/RNA-binding 3-helical bundle
Superfamily Superfamily superfamily	a.4.6 — C-terminal effector domain of the bipartite response regulators
Family Family family	a.4.6.2 — GerE-like (LuxR/UhpA family of transcriptional regulators)

Domain ID domain_id	d1je8b_
Class class	a — All alpha proteins
Fold Fold fold	a.4 — DNA/RNA-binding 3-helical bundle
Superfamily Superfamily superfamily	a.4.6 — C-terminal effector domain of the bipartite response regulators
Family Family family	a.4.6.2 — GerE-like (LuxR/UhpA family of transcriptional regulators)

Domain ID domain_id	d1je8e_
Class class	a — All alpha proteins
Fold Fold fold	a.4 — DNA/RNA-binding 3-helical bundle
Superfamily Superfamily superfamily	a.4.6 — C-terminal effector domain of the bipartite response regulators
Family Family family	a.4.6.2 — GerE-like (LuxR/UhpA family of transcriptional regulators)

Domain ID domain_id	d1je8f_
Class class	a — All alpha proteins
Fold Fold fold	a.4 — DNA/RNA-binding 3-helical bundle
Superfamily Superfamily superfamily	a.4.6 — C-terminal effector domain of the bipartite response regulators
Family Family family	a.4.6.2 — GerE-like (LuxR/UhpA family of transcriptional regulators)

CATH v4.4 (4 domains)

Domain ID domain_id	1je8A00
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	10 — Arc Repressor Mutant, subunit A
Homologous superfamily homologous superfamily	10 — Winged helix-like DNA-binding domain superfamily/Winged helix DNA-binding domain

Domain ID domain_id	1je8B00
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	10 — Arc Repressor Mutant, subunit A
Homologous superfamily homologous superfamily	10 — Winged helix-like DNA-binding domain superfamily/Winged helix DNA-binding domain

Domain ID domain_id	1je8E00
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	10 — Arc Repressor Mutant, subunit A
Homologous superfamily homologous superfamily	10 — Winged helix-like DNA-binding domain superfamily/Winged helix DNA-binding domain

Domain ID domain_id	1je8F00
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	10 — Arc Repressor Mutant, subunit A
Homologous superfamily homologous superfamily	10 — Winged helix-like DNA-binding domain superfamily/Winged helix DNA-binding domain

▶

8. Citations (1)

▶

Unit-cell length a length_a	76.257 Å
Unit-cell length b length_b	52.741 Å
Unit-cell length c length_c	83.863 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	90.00 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	8

Space group space_group	P 1 21 1
Space-group number int_tables_number	4
Crystal system crystal_system	—

Resolution resolution	2.120 Å
Low-resolution limit resolution_low	8.970 Å
R factor r_factor	—
R_work r_work	0.2280
R_free r_free	0.2730

fit	/app/data/saxs_computation/je/1je8/1je8.fit
pddf	/app/data/pr_computation/je/1je8/1je8.pr.out
profile	/app/data/saxs_computation/je/1je8/1je8.dat

Two-Component response regulator NarL/DNA Complex: DNA Bending Found in a High Affinity Site

1. Protein Identity and Related Structures Protein Identity & Related Structures

Nitrate/Nitrite Response Regulator Protein NARL

State in the Current Structure

Other States of the Same Protein in the Database

SAXS scattering curve SAXS Profile

P(r) Distance Distribution P(r) Distribution

2. Structure Basics 2. Structure Basics

3. SAXS Parameters (CRYSOL theoretical calculation) 3. SAXS Parameters (CRYSOL)

4. P(r) Distance Distribution (GNOM inversion) 4. P(r) Analysis (GNOM)

5. Crystallography and Experiment 5. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

6. Entities and Polymers Entities & Polymers (4)

Entity 1 Entity 1 polymer

Polymer Polymer

Entity 2 Entity 2 polymer

Polymer Polymer

来源 Source

Entity 3 Entity 3 non-polymer

Entity 4 Entity 4 water

7. Fold Classification (SCOP + CATH) 8 domains

SCOP 2.08 (4 domains)

CATH v4.4 (4 domains)

8. Citations (1)

9. Files and Curves (10)

Files (7)

Curves (3)