SAXSdb — 1ls2

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

Elongation Factor Tu

OrganismNot specified

State in the Current Structure

Assembly	Oligomeric State	Construct	Mutations and Modifications	Ligands, Ions and Associated Components	Method and Experimental Conditions	Structure Quality
1	Protein–RNA Monomer Protein × 1 RNA 1 PDB declaration: dimeric（2） Consistent with all polymer counts	Chain A； UniProt 1–393	Not recorded	Phenylalanine transfer RNA × 1	ELECTRON MICROSCOPY cryo-EM buffer：Hepes-KOH buffer at pH 7.5；pH 7.5；Hepes-KOH buffer at pH 7.5 cryo-EM vitrification conditions：Cryogen ETHANE；Rapid-freezing in liquid ethane	Resolution 16.80 Å

Other States of the Same Protein in the Database

Each row is a biological assembly of the same UniProt protein in another PDB entry. The “Difference from current entry” column identifies evidence-level differences; no tag means the currently parsed fields agree.

Other PDB	Difference from Current Entry 1LS2	Assembly / Oligomeric State	Construct	Mutations and Modifications	Ligands, Ions and Non-polymers	Method and Experimental Conditions	Structure Quality
1D8T CRYSTAL STRUCTURE OF ELONGATION FACTOR, TU (EF-TU-MGGDP) COMPLEXED WITH GE2270A, A THIAZOLYL PEPTIDE ANTIBIOTIC Deposited 1999-10-25	Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein heterocomplex Heteromer；Protein × 2 PDB declaration: dimeric	Chain A 1–393（393 aa）	Not recorded	MG MAGNESIUM ION × 1 GDP GUANOSINE-5'-DIPHOSPHATE × 1 ACT ACETATE ION × 19	X-RAY DIFFRACTION X-ray crystallization conditions pH 7.6；TRIS-HCL, MAGNESIUM CHLORIDE, GDP, POLYETHYLENE GLYCOL 3350, AMMONIUM ACETATE, AMMONIUM CITRATE, PH 7.6, VAPOR DIFFUSION, SITTING DROP, TEMPERATURE 293.K	Resolution 2.35 Å R-free 0.246
1D8T CRYSTAL STRUCTURE OF ELONGATION FACTOR, TU (EF-TU-MGGDP) COMPLEXED WITH GE2270A, A THIAZOLYL PEPTIDE ANTIBIOTIC Deposited 1999-10-25	Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 2 Protein heterocomplex Heteromer；Protein × 2 PDB declaration: dimeric	Chain B 1–393（393 aa）	Not recorded	MG MAGNESIUM ION × 1 GDP GUANOSINE-5'-DIPHOSPHATE × 1 ACT ACETATE ION × 11	X-RAY DIFFRACTION X-ray crystallization conditions pH 7.6；TRIS-HCL, MAGNESIUM CHLORIDE, GDP, POLYETHYLENE GLYCOL 3350, AMMONIUM ACETATE, AMMONIUM CITRATE, PH 7.6, VAPOR DIFFUSION, SITTING DROP, TEMPERATURE 293.K	Resolution 2.35 Å R-free 0.246
1DG1 WHOLE, UNMODIFIED, EF-TU(ELONGATION FACTOR TU). Deposited 1999-11-22	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein homooligomer Homooligomer；Protein × 2 PDB declaration: dimeric	Chain G 1–394（394 aa） Chain H 1–394（394 aa）	Not recorded	MG MAGNESIUM ION × 2 GDP GUANOSINE-5'-DIPHOSPHATE × 2	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION；pH 5.75；298 K；PEG 3350, ammonium citrate, ammonium acetate, pH 5.75, VAPOR DIFFUSION, temperature 298.0K	Resolution 2.50 Å R-free 0.259
1EFC INTACT ELONGATION FACTOR FROM E.COLI Deposited 1998-11-24	Different construct Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain A 2–394（393 aa）	Not recorded	MG MAGNESIUM ION × 1 GDP GUANOSINE-5'-DIPHOSPHATE × 1	X-RAY DIFFRACTION X-ray crystallization conditions pH 7.5；pH 7.5	Resolution 2.05 Å R-free 0.268
1EFC INTACT ELONGATION FACTOR FROM E.COLI Deposited 1998-11-24	Different construct Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 2 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain B 2–394（393 aa）	Not recorded	MG MAGNESIUM ION × 1 GDP GUANOSINE-5'-DIPHOSPHATE × 1	X-RAY DIFFRACTION X-ray crystallization conditions pH 7.5；pH 7.5	Resolution 2.05 Å R-free 0.268
1EFU ELONGATION FACTOR COMPLEX EF-TU/EF-TS FROM ESCHERICHIA COLI Deposited 1996-07-09	Different construct Different mutation/modification Different oligomeric state Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein heterocomplex Heteromer；Protein × 4 PDB declaration: tetrameric	Chain A 9–393（385 aa） Chain C 9–393（385 aa）	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions pH 7.7；pH 7.7	Resolution 2.50 Å R-free 0.283
1ETU STRUCTURAL DETAILS OF THE BINDING OF GUANOSINE DIPHOSPHATE TO ELONGATION FACTOR TU FROM E. COLI AS STUDIED BY X-RAY CRYSTALLOGRAPHY Deposited 1988-01-15	Different construct Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain A 1–392（392 aa）	Not recorded	MG MAGNESIUM ION × 1 GDP GUANOSINE-5'-DIPHOSPHATE × 1	X-RAY DIFFRACTION mmCIF provides none of the parsed conditions	Resolution 2.90 Å
1QZD EF-Tu.kirromycin coordinates fitted into the cryo-EM map of EF-Tu ternary complex (GDP.Kirromycin) bound 70S ribosome Deposited 2003-09-16	Different oligomeric state Different experimental conditions Different structure-quality metrics	Assembly 1 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain A 1–393（393 aa）	Not recorded	No recorded non-water small molecule	ELECTRON MICROSCOPY cryo-EM buffer Polymix buffer；pH 7.5；Polymix buffer cryo-EM vitrification conditions Cryogen ETHANE；Rapid-freezing in liquid ethane	Resolution 10.00 Å
2BVN E. coli EF-Tu:GDPNP in complex with the antibiotic enacyloxin IIa Deposited 2005-06-30	Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain A 1–393（393 aa）	Not recorded	GNP PHOSPHOAMINOPHOSPHONIC ACID-GUANYLATE ESTER × 1 MG MAGNESIUM ION × 1 ENX ENACYLOXIN IIA × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 6.8；292 K；2 MICROL PROTEIN SOLUTION MIXED WITH 1 MICROL RESERVOIR SOLUTION (450 MM NACL. 22% PEG6000, 6% GLYCEROL, 7 MM MGCL2, 100 MM TRIS-HCL PH 7.5), SITTING DROP 19 DEG. C	Resolution 2.30 Å R-free 0.271
2BVN E. coli EF-Tu:GDPNP in complex with the antibiotic enacyloxin IIa Deposited 2005-06-30	Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 2 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain B 1–393（393 aa）	Not recorded	GNP PHOSPHOAMINOPHOSPHONIC ACID-GUANYLATE ESTER × 1 MG MAGNESIUM ION × 1 ENX ENACYLOXIN IIA × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 6.8；292 K；2 MICROL PROTEIN SOLUTION MIXED WITH 1 MICROL RESERVOIR SOLUTION (450 MM NACL. 22% PEG6000, 6% GLYCEROL, 7 MM MGCL2, 100 MM TRIS-HCL PH 7.5), SITTING DROP 19 DEG. C	Resolution 2.30 Å R-free 0.271
2HCJ Trypsin-modified Elongation Factor Tu in complex with tetracycline Deposited 2006-06-16	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein homooligomer Homooligomer；Protein × 2 PDB declaration: dimeric	Chain A 8–44（37 aa） Fragment：EF-Tu fragment, residues 8-44 Chain B 59–393（335 aa） Fragment：EF-Tu fragment, residues 59-393	Non-standard monomer：Yes (specific site not provided by mmCIF)	MG MAGNESIUM ION × 1 SO4 SULFATE ION × 1 GDP GUANOSINE-5'-DIPHOSPHATE × 1 NA SODIUM ION × 3 TAC TETRACYCLINE × 1 GLV GLYOXYLIC ACID × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；VAPOR DIFFUSION, SITTING DROP	Resolution 2.12 Å R-free 0.234
2HDN Trypsin-modified Elongation Factor Tu in complex with tetracycline at 2.8 Angstrom resolution Deposited 2006-06-20	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein homooligomer Homooligomer；Protein × 2 PDB declaration: dimeric	Chain A 8–44（37 aa） Fragment：EF-Tu fragment, residues 8-44 Chain B 59–393（335 aa） Fragment：EF-Tu fragment, residues 59-393	Not recorded	MG MAGNESIUM ION × 1 GDP GUANOSINE-5'-DIPHOSPHATE × 1 TAC TETRACYCLINE × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；Multiple crystals were used to collect the native and each derivative data set. VAPOR DIFFUSION, SITTING DROP	Resolution 2.80 Å R-free 0.223
2HDN Trypsin-modified Elongation Factor Tu in complex with tetracycline at 2.8 Angstrom resolution Deposited 2006-06-20	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 2 Protein homooligomer Homooligomer；Protein × 2 PDB declaration: dimeric	Chain C 8–44（37 aa） Fragment：EF-Tu fragment, residues 8-44 Chain D 59–393（335 aa） Fragment：EF-Tu fragment, residues 59-393	Not recorded	MG MAGNESIUM ION × 1 GDP GUANOSINE-5'-DIPHOSPHATE × 1 TAC TETRACYCLINE × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；Multiple crystals were used to collect the native and each derivative data set. VAPOR DIFFUSION, SITTING DROP	Resolution 2.80 Å R-free 0.223
2HDN Trypsin-modified Elongation Factor Tu in complex with tetracycline at 2.8 Angstrom resolution Deposited 2006-06-20	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 3 Protein homooligomer Homooligomer；Protein × 2 PDB declaration: dimeric	Chain E 8–44（37 aa） Fragment：EF-Tu fragment, residues 8-44 Chain F 59–393（335 aa） Fragment：EF-Tu fragment, residues 59-393	Not recorded	MG MAGNESIUM ION × 1 GDP GUANOSINE-5'-DIPHOSPHATE × 1 TAC TETRACYCLINE × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；Multiple crystals were used to collect the native and each derivative data set. VAPOR DIFFUSION, SITTING DROP	Resolution 2.80 Å R-free 0.223
2HDN Trypsin-modified Elongation Factor Tu in complex with tetracycline at 2.8 Angstrom resolution Deposited 2006-06-20	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 4 Protein homooligomer Homooligomer；Protein × 2 PDB declaration: dimeric	Chain G 8–44（37 aa） Fragment：EF-Tu fragment, residues 8-44 Chain H 59–393（335 aa） Fragment：EF-Tu fragment, residues 59-393	Not recorded	MG MAGNESIUM ION × 1 GDP GUANOSINE-5'-DIPHOSPHATE × 1 TAC TETRACYCLINE × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；Multiple crystals were used to collect the native and each derivative data set. VAPOR DIFFUSION, SITTING DROP	Resolution 2.80 Å R-free 0.223
2HDN Trypsin-modified Elongation Factor Tu in complex with tetracycline at 2.8 Angstrom resolution Deposited 2006-06-20	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 5 Protein homooligomer Homooligomer；Protein × 2 PDB declaration: dimeric	Chain I 8–44（37 aa） Fragment：EF-Tu fragment, residues 8-44 Chain J 59–393（335 aa） Fragment：EF-Tu fragment, residues 59-393	Not recorded	MG MAGNESIUM ION × 1 GDP GUANOSINE-5'-DIPHOSPHATE × 1 TAC TETRACYCLINE × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；Multiple crystals were used to collect the native and each derivative data set. VAPOR DIFFUSION, SITTING DROP	Resolution 2.80 Å R-free 0.223
2HDN Trypsin-modified Elongation Factor Tu in complex with tetracycline at 2.8 Angstrom resolution Deposited 2006-06-20	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 6 Protein homooligomer Homooligomer；Protein × 2 PDB declaration: dimeric	Chain K 8–44（37 aa） Fragment：EF-Tu fragment, residues 8-44 Chain L 59–393（335 aa） Fragment：EF-Tu fragment, residues 59-393	Not recorded	MG MAGNESIUM ION × 1 GDP GUANOSINE-5'-DIPHOSPHATE × 1 TAC TETRACYCLINE × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；Multiple crystals were used to collect the native and each derivative data set. VAPOR DIFFUSION, SITTING DROP	Resolution 2.80 Å R-free 0.223
2HDN Trypsin-modified Elongation Factor Tu in complex with tetracycline at 2.8 Angstrom resolution Deposited 2006-06-20	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 7 Protein homooligomer Homooligomer；Protein × 4 PDB declaration: tetrameric	Chain A 8–44（37 aa） Fragment：EF-Tu fragment, residues 8-44 Chain B 59–393（335 aa） Fragment：EF-Tu fragment, residues 59-393 Chain C 8–44（37 aa） Fragment：EF-Tu fragment, residues 8-44 Chain D 59–393（335 aa） Fragment：EF-Tu fragment, residues 59-393	Not recorded	MG MAGNESIUM ION × 2 GDP GUANOSINE-5'-DIPHOSPHATE × 2 TAC TETRACYCLINE × 2	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；Multiple crystals were used to collect the native and each derivative data set. VAPOR DIFFUSION, SITTING DROP	Resolution 2.80 Å R-free 0.223
2HDN Trypsin-modified Elongation Factor Tu in complex with tetracycline at 2.8 Angstrom resolution Deposited 2006-06-20	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 8 Protein homooligomer Homooligomer；Protein × 4 PDB declaration: tetrameric	Chain I 8–44（37 aa） Fragment：EF-Tu fragment, residues 8-44 Chain J 59–393（335 aa） Fragment：EF-Tu fragment, residues 59-393 Chain K 8–44（37 aa） Fragment：EF-Tu fragment, residues 8-44 Chain L 59–393（335 aa） Fragment：EF-Tu fragment, residues 59-393	Not recorded	MG MAGNESIUM ION × 2 GDP GUANOSINE-5'-DIPHOSPHATE × 2 TAC TETRACYCLINE × 2	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；Multiple crystals were used to collect the native and each derivative data set. VAPOR DIFFUSION, SITTING DROP	Resolution 2.80 Å R-free 0.223
2HDN Trypsin-modified Elongation Factor Tu in complex with tetracycline at 2.8 Angstrom resolution Deposited 2006-06-20	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 9 Protein homooligomer Homooligomer；Protein × 4 PDB declaration: tetrameric	Chain E 8–44（37 aa） Fragment：EF-Tu fragment, residues 8-44 Chain F 59–393（335 aa） Fragment：EF-Tu fragment, residues 59-393 Chain G 8–44（37 aa） Fragment：EF-Tu fragment, residues 8-44 Chain H 59–393（335 aa） Fragment：EF-Tu fragment, residues 59-393	Not recorded	MG MAGNESIUM ION × 2 GDP GUANOSINE-5'-DIPHOSPHATE × 2 TAC TETRACYCLINE × 2	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；Multiple crystals were used to collect the native and each derivative data set. VAPOR DIFFUSION, SITTING DROP	Resolution 2.80 Å R-free 0.223
3EP2 Model of Phe-tRNA(Phe) in the ribosomal pre-accommodated state revealed by cryo-EM Deposited 2008-09-29	Different construct Different oligomeric state Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–RNA Heteromer；Protein × 3 PDB declaration: nonameric	Chain X 2–394（393 aa）	Not recorded	No recorded non-water small molecule	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 9.00 Å
3EQ3 Model of tRNA(Trp)-EF-Tu in the ribosomal pre-accommodated state revealed by cryo-EM Deposited 2008-09-30	Different construct Different oligomeric state Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–RNA Heteromer；Protein × 3 PDB declaration: nonameric	Chain X 2–394（393 aa）	Not recorded	No recorded non-water small molecule	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5；HiFi buffer (50 mM Tris-HCl pH 7.5, 70mM NH4Cl, 30 mM KCl, 3.5 mM MgCl2, 0.5 mM spermidine, 8mM putrescine, 2 mM DTT, 3.5 mM MgCl2) cryo-EM vitrification conditions Cryogen NITROGEN	Resolution 9.00 Å
3EQ4 Model of tRNA(Leu)-EF-Tu in the ribosomal pre-accommodated state revealed by cryo-EM Deposited 2008-09-30	Different construct Different oligomeric state Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–RNA Heteromer；Protein × 3 PDB declaration: nonameric	Chain X 2–394（393 aa）	Not recorded	No recorded non-water small molecule	ELECTRON MICROSCOPY cryo-EM buffer pH 7.3；Polymix buffer( 5 mM potassium phosphate (KH2PO4) pH 7.3, 5 mM NH4Cl, 95 mM KCl, 0.5 mM CaCl2, 8 mM putrescine, 1 mM spermidine, 1 mM DTE, 5 mM magnesium acetate) cryo-EM vitrification conditions Cryogen NITROGEN	Resolution 12.00 Å
4V69 Ternary complex-bound E.coli 70S ribosome. Deposited 2008-12-11	Different construct Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–RNA Heteromer；Protein × 51 PDB declaration: 58-meric	Chain AZ 2–394（393 aa）	Not recorded	GDP GUANOSINE-5'-DIPHOSPHATE × 1	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE；Vitrification using FEI Vitrobot; blot 3 seconds before plunging with an offset of -1mm	Resolution 6.70 Å

13 other PDB entries and 24 assemblies. Open the comparison page and filter oligomeric states

View Construct and Data Evidence

UniProt name	EFTU_ECOLI
Isoform	—
PDB entities	2
Chains and sequence ranges	Author chain A； PDBConstruct 1–393； UniProt 1–393

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	1ls2
Deposition date deposition_date	2002-05-16
Structure title title	Fitting of EF-Tu and tRNA in the Low Resolution Cryo-EM Map of an EF-Tu Ternary Complex (GDP and Kirromycin) Bound to E. coli 70S Ribosome
Keywords keywords	EF-Tu, ternary complex, cryo-EM, 70S E.coli ribosome, TRANSLATION-RNA COMPLEX; TRANSLATION/RNA
Experimental Method method	ELECTRON MICROSCOPY

▼

3. SAXS Parameters (CRYSOL theoretical calculation) 3. SAXS Parameters (CRYSOL)

Radius of gyration Rg (Guinier) rg_guinier	27.17 Å
Radius of gyration Rg (electron density) rg_electron	24.24 Å
Forward intensity I(0) i0	41115800.00
Molecular weight molecular_weight	44632.0 kDa
Excluded volume excluded_volume	52424 Å³
Envelope volume envelope_volume	59057 Å³
Hydration-shell volume shell_volume	20320 Å³
Envelope diameter envelope_diameter	106.7 Å
Shell Rg shell_rg	29.75 Å
Envelope Rg envelope_rg	29.04 Å
Shape Rg shape_rg	27.19 Å
Total Rg total_rg	24.66 Å
Total atoms total_atoms	76
Residues n_residues	76
Spherical-harmonic order n_harmonics	20
q range q_range	— – 0.5000 Å⁻¹
Data points n_points	101
Shell type shell_type	directional
Solvent electron density solvent_density	0.3340 e/Å³
Shell contrast contrast_shell	0.0300 e/Å³
CRYSOL version crysol_version	4.1.3

▼

4. P(r) Distance Distribution (GNOM inversion) 4. P(r) Analysis (GNOM)

Maximum dimension Dmax dmax	102.5 Å
Rg (real space) rg_real	27.60 Å
Rg uncertainty (real space) rg_real_error	0.91 Å
I(0) (real space) i0_real	4.1110e+07
I(0) uncertainty (real space) i0_real_error	6.9080e+05
Rg (reciprocal space) rg_reciprocal	27.46 Å
I(0) (reciprocal space) i0_reciprocal	41110000.0000
Solution quality estimate total_estimate	0.7870
Solution quality rating solution_quality	GOOD a GOOD solution
P(r) peaks n_peaks	2
Primary peak position r_peak_primary	28.3 Å
Skewness Skewness skewness	0.832
Kurtosis Kurtosis kurtosis	0.706
Angular range angular_range	— – 0.2900 Å⁻¹
Current regularization parameter α current_alpha	0.0000
Highest regularization parameter α highest_alpha	10440000.0000
Real-space data points n_real_points	59
GNOM version gnom_version	4.1.3
Quality Criteria quality_criteria	AN1: 0.000; Oscil: 0.511; Stabil: 1.000; Sysdev: 1.000; Positv: 1.000; Valcen: 0.714; Smooth: 0.979

▶

5. Crystallography and Experiment 5. Crystallography & Experiment

▶

6. Entities and Polymers Entities & Polymers (2)

Entity 1 Entity 1 polymer

Description description	Phenylalanine transfer RNA
Molecular weight formula_weight	24518.6 kDa
Source method src_method	nat
Copy count entity_count	1

Polymer Polymer

Polymer type type	polyribonucleotide
Chain IDs strand_id	B
Atom count atom_count	462

GCGGAUUUAGCUCAGUUGGGAGAGCGCCAGACUGAAGAUCUGGAGGUCCUGUGUUCGAUCCACAGAAUUCGCACCA

Entity 2 Entity 2 polymer

Description description	Elongation Factor Tu
Molecular weight formula_weight	43239.3 kDa
Source method src_method	nat
Copy count entity_count	1

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A

SKEKFERTKPHVNVGTIGHVDHGKTTLTAAITTVLAKTYGGAARAFDQIDNAPEEKARGITINTSHVEYDTPTRHYAHVDCPGHADYVKNMITGAAQMDGAILVVAATDGPMPQTREHILLGRQVGVPYIIVFLNKCDMVDDEELLELVEMEVRELLSQYDFPGDDTPIVRGSALKALEGDAEWEAKILELAGFLDSYIPEPERAIDKPFLLPIEDVFSISGRGTVVTGRVERGIIKVGEEVEIVGIKETQKSTCTGVEMFRKLLDEGRAGENVGVLLRGIKREEIERGQVLAKPGTIKPHTKFESEVYILSKDEGGRHTPFFKGYRPQFYFRTTDVTGTIELPEGVEMVMPGDNIKMVVTLIHPIAMDDGLRFAIREGGRTVGAGVVAKVLS

▼

7. Fold Classification (SCOP + CATH) 1 domains

SCOP 2.08 (1 domains)

Domain ID domain_id	d1ls2a_
Class class	i — Low resolution protein structures
Fold Fold fold	i.1 — Ribosome and ribosomal fragments
Superfamily Superfamily superfamily	i.1.1 — Ribosome and ribosomal fragments
Family Family family	i.1.1.1 — Ribosome complexes

▶

8. Citations (6)

▶

Resolution resolution	16.800 Å
Low-resolution limit resolution_low	— Å
R factor r_factor	—
R_work r_work	—
R_free r_free	—

Resolution resolution	16.80 Å
Resolution测定方法 resolution_method	reference based alignment
颗粒数 num_particles	7985

fit	/app/data/saxs_computation/ls/1ls2/1ls2.fit
pddf	/app/data/pr_computation/ls/1ls2/1ls2.pr.out
profile	/app/data/saxs_computation/ls/1ls2/1ls2.dat

Fitting of EF-Tu and tRNA in the Low Resolution Cryo-EM Map of an EF-Tu Ternary Complex (GDP and Kirromycin) Bound to E. coli 70S Ribosome

1. Protein Identity and Related Structures Protein Identity & Related Structures

Elongation Factor Tu

State in the Current Structure

Other States of the Same Protein in the Database

SAXS scattering curve SAXS Profile

P(r) Distance Distribution P(r) Distribution

2. Structure Basics 2. Structure Basics

3. SAXS Parameters (CRYSOL theoretical calculation) 3. SAXS Parameters (CRYSOL)

4. P(r) Distance Distribution (GNOM inversion) 4. P(r) Analysis (GNOM)

5. Crystallography and Experiment 5. Crystallography & Experiment

Refinement Refinement

冷冻电镜 EM 3D

6. Entities and Polymers Entities & Polymers (2)

Entity 1 Entity 1 polymer

Polymer Polymer

Entity 2 Entity 2 polymer

Polymer Polymer

7. Fold Classification (SCOP + CATH) 1 domains

SCOP 2.08 (1 domains)

8. Citations (6)

9. Files and Curves (10)

Files (7)

Curves (3)