SAXSdb — 1tl8

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

DNA topoisomerase I

Homo sapiens

State in the Current Structure

Assembly	Oligomeric State	Construct	Mutations and Modifications	Ligands, Ions and Associated Components	Method and Experimental Conditions	Structure Quality
1	Protein–DNA Monomer Protein × 1 DNA 3 PDB declaration: tetrameric（4） Consistent with all polymer counts	Chain A； UniProt 174–765	Non-standard monomer：Yes (specific site not provided by mmCIF)	5'-D(APAPAPAPAPGPAPCPTPT)-3' × 1 5'-D((TPC)PGPAPAPAPAPAPTPTPTPTPT)-3' × 1 5'-D(APAPAPAPAPTPTPTPTPTPCPGPAPAPGPTPCPTPTPTPTPT)-3' × 1 AI3 2,3-DIMETHOXY-12H-[1,3]DIOXOLO[5,6]INDENO[1,2-C]ISOQUINOLIN-6-IUM × 1	X-RAY DIFFRACTION X-ray crystallization conditions：VAPOR DIFFUSION, SITTING DROP；pH 6.4；289 K；PEG 8000, MES, Ammonium Sulfate, pH 6.40, VAPOR DIFFUSION, SITTING DROP, temperature 289K	Resolution 3.10 Å R-free 0.305

Other States of the Same Protein in the Database

Each row is a biological assembly of the same UniProt protein in another PDB entry. The “Difference from current entry” column identifies evidence-level differences; no tag means the currently parsed fields agree.

Other PDB	Difference from Current Entry 1TL8	Assembly / Oligomeric State	Construct	Mutations and Modifications	Ligands, Ions and Non-polymers	Method and Experimental Conditions	Structure Quality
1A35 HUMAN TOPOISOMERASE I/DNA COMPLEX Deposited 1998-01-29	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: trimeric	Chain A 175–765（591 aa） Fragment：CORE DOMAIN AND C-TERMINAL DOMAIN	Mutation：Y723F	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 7.7；295 K；pH 7.70, VAPOR DIFFUSION, SITTING DROP, temperature 295.00K	Resolution 2.50 Å R-free 0.308
1A36 TOPOISOMERASE I/DNA COMPLEX Deposited 1998-01-29	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: trimeric	Chain A 174–765（592 aa） Fragment：CORE DOMAIN AND C-TERMINAL DOMAIN	Mutation：Y723F	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions pH 7.7；pH 7.70	Resolution 2.80 Å R-free 0.312
1EJ9 CRYSTAL STRUCTURE OF HUMAN TOPOISOMERASE I DNA COMPLEX Deposited 2000-03-01	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: trimeric	Chain A 203–765（563 aa） Fragment：C-TERMINAL DOMAIN, RESIDUES 203-765	Mutation：Y723F	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 6.8；295 K；27% PEG 400, 145 mM MgCl2, 20 mM MES pH 6.8, 5 mM Tris pH 8.0, 30 mM DTT, VAPOR DIFFUSION, SITTING DROP, temperature 295K	Resolution 2.60 Å R-free 0.281
1K4S HUMAN DNA TOPOISOMERASE I IN COVALENT COMPLEX WITH A 22 BASE PAIR DNA DUPLEX Deposited 2001-10-08	Different construct Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: tetrameric	Chain A 174–765（592 aa） Fragment：Core Domain and C-Terminal Domain, Residues 174-765	Non-standard monomer：Yes (specific site not provided by mmCIF)	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 8；289 K；PEG 8000, Tris-HCl, Na/K Phosphate, KCl, DTT, VAPOR DIFFUSION, SITTING DROP, temperature 289K	Resolution 3.20 Å R-free 0.222
1K4T HUMAN DNA TOPOISOMERASE I (70 KDA) IN COMPLEX WITH THE POISON TOPOTECAN AND COVALENT COMPLEX WITH A 22 BASE PAIR DNA DUPLEX Deposited 2001-10-08	Different construct Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: tetrameric	Chain A 174–765（592 aa） Fragment：Core Domain and C-Terminal Domain, Residues 174-765	Non-standard monomer：Yes (specific site not provided by mmCIF)	TTG 2-(1-DIMETHYLAMINOMETHYL-2-HYDROXY-8-HYDROXYMETHYL-9-OXO-9,11-DIHYDRO-INDOLIZINO[1,2-B]QUINOLIN-7-YL)-2-HYDROXY-BUTYRIC ACID × 1 TTC (S)-10-[(DIMETHYLAMINO)METHYL]-4-ETHYL-4,9-DIHYDROXY-1H-PYRANO[3',4':6,7]INOLIZINO[1,2-B]-QUINOLINE-3,14(4H,12H)-DIONE × 1 HG MERCURY (II) ION × 1 PG4 TETRAETHYLENE GLYCOL × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 6.5；289 K；PEG 8000, Ammonium Sulfate, MES, pH 6.5, VAPOR DIFFUSION, SITTING DROP, temperature 289K	Resolution 2.10 Å R-free 0.269
1LPQ Human DNA Topoisomerase I (70 Kda) In Non-Covalent Complex With A 22 Base Pair DNA Duplex Containing an 8-oxoG Lesion Deposited 2002-05-08	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: trimeric	Chain A 202–765（564 aa）	Mutation：Y723F	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 6.8；295 K；Tris-HCl, MES, PEG 400, Magnesium chloride, dithiothreitol, pH 6.8, VAPOR DIFFUSION, HANGING DROP, temperature 295K	Resolution 3.14 Å R-free 0.298
1NH3 Human Topoisomerase I Ara-C Complex Deposited 2002-12-18	Different construct Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: tetrameric	Chain A 203–764（562 aa） Fragment：Core Subdomain, C-Terminal Domain	Non-standard monomer：Yes (specific site not provided by mmCIF)	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 7.7；276 K；Tris, Magnesium Chloride, PEG 400, DTT, pH 7.7, VAPOR DIFFUSION, SITTING DROP, temperature 276K	Resolution 3.10 Å R-free 0.311
1R49 Human topoisomerase I (Topo70) double mutant K532R/Y723F Deposited 2003-10-03	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: trimeric	Chain A 174–765（592 aa） Fragment：Topo70	Mutation：K532R, Y723F	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION；pH 7.5；298 K；PEG 3350 MME, Magnesium chloride, MES, TCEP, pH 7.5, VAPOR DIFFUSION, temperature 298K	Resolution 3.13 Å R-free 0.339
1RR8 Structural Mechanisms of Camptothecin Resistance by Mutations in Human Topoisomerase I Deposited 2003-12-08	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: trimeric	Chain C 203–765（563 aa）	Mutation：F361S,Q634R Non-standard monomer：Yes (specific site not provided by mmCIF)	TTG 2-(1-DIMETHYLAMINOMETHYL-2-HYDROXY-8-HYDROXYMETHYL-9-OXO-9,11-DIHYDRO-INDOLIZINO[1,2-B]QUINOLIN-7-YL)-2-HYDROXY-BUTYRIC ACID × 1 TTC (S)-10-[(DIMETHYLAMINO)METHYL]-4-ETHYL-4,9-DIHYDROXY-1H-PYRANO[3',4':6,7]INOLIZINO[1,2-B]-QUINOLINE-3,14(4H,12H)-DIONE × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 6.5；289 K；PEG 8000, 200mM Lithium Sulfate, 100mM Mes, pH 6.5, VAPOR DIFFUSION, HANGING DROP, temperature 289K	Resolution 2.60 Å R-free 0.294
1RRJ Structural Mechanisms of Camptothecin Resistance by Mutations in Human Topoisomerase I Deposited 2003-12-08	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: trimeric	Chain A 201–765（565 aa）	Mutation：Asn722Ser Non-standard monomer：Yes (specific site not provided by mmCIF)	TTG 2-(1-DIMETHYLAMINOMETHYL-2-HYDROXY-8-HYDROXYMETHYL-9-OXO-9,11-DIHYDRO-INDOLIZINO[1,2-B]QUINOLIN-7-YL)-2-HYDROXY-BUTYRIC ACID × 1 TTC (S)-10-[(DIMETHYLAMINO)METHYL]-4-ETHYL-4,9-DIHYDROXY-1H-PYRANO[3',4':6,7]INOLIZINO[1,2-B]-QUINOLINE-3,14(4H,12H)-DIONE × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 6.5；289 K；PEG8000, 200mM lithium sulfate, 100mM Mes, pH 6.5, VAPOR DIFFUSION, HANGING DROP, temperature 289K	Resolution 2.30 Å R-free 0.278
1SC7 Human DNA Topoisomerase I (70 Kda) In Complex With The Indenoisoquinoline MJ-II-38 and Covalent Complex With A 22 Base Pair DNA Duplex Deposited 2004-02-11	Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: tetrameric	Chain A 174–765（592 aa）	Non-standard monomer：Yes (specific site not provided by mmCIF)	M38 4-(5,11-DIOXO-5H-INDENO[1,2-C]ISOQUINOLIN-6(11H)-YL)BUTANOATE × 1 PG4 TETRAETHYLENE GLYCOL × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 6.4；289 K；PEG 8000, AMMONIUM SULFATE, MES, pH 6.4, VAPOR DIFFUSION, SITTING DROP, temperature 289K	Resolution 3.00 Å R-free 0.285
1SEU Human DNA Topoisomerase I (70 Kda) In Complex With The Indolocarbazole SA315F and Covalent Complex With A 22 Base Pair DNA Duplex Deposited 2004-02-18	Different mutation/modification Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: tetrameric	Chain A 174–765（592 aa）	Mutation：Asn722Ser Non-standard monomer：Yes (specific site not provided by mmCIF)	SA3 2,10-DIHYDROXY-12-(BETA-D-GLUCOPYRANOSYL)-6,7,12,13-TETRAHYDROINDOLO[2,3-A]PYRROLO[3,4-C]CARBAZOLE-5,7-DIONE × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 6.4；289 K；PEG 8000, AMMONIUM SULFATE, MES, pH 6.4, VAPOR DIFFUSION, SITTING DROP, temperature 289K	Resolution 3.00 Å R-free 0.295
1T8I Human DNA Topoisomerase I (70 Kda) In Complex With The Poison Camptothecin and Covalent Complex With A 22 Base Pair DNA Duplex Deposited 2004-05-12	Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: tetrameric	Chain A 174–765（592 aa）	Non-standard monomer：Yes (specific site not provided by mmCIF)	EHD 4-ETHYL-4-HYDROXY-1,12-DIHYDRO-4H-2-OXA-6,12A-DIAZA-DIBENZO[B,H]FLUORENE-3,13-DIONE × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 6.4；289 K；PEG 8000, ammonium sulfate, MES, pH 6.4, VAPOR DIFFUSION, SITTING DROP, temperature 289K	Resolution 3.00 Å R-free 0.292

13 other PDB entries and 13 assemblies. Open the comparison page and filter oligomeric states

View Construct and Data Evidence

UniProt name	TOP1_HUMAN
Isoform	—
PDB entities	4
Chains and sequence ranges	Author chain A； PDBConstruct 1–592； UniProt 174–765

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	1tl8
Deposition date deposition_date	2004-06-09
Structure title title	Human DNA topoisomerase I (70 kDa) in complex with the indenoisoquinoline AI-III-52 and covalent complex with a 22 base pair DNA duplex
Keywords keywords	COMPLEX (ISOMERASE-DNA), DNA, TOPOISOMERASE I, DRUG, POISON, IDENOISOQUINOLINE, ISOMERASE-DNA complex; ISOMERASE/DNA
Experimental Method method	X-RAY DIFFRACTION

▼

3. SAXS Parameters (CRYSOL theoretical calculation) 3. SAXS Parameters (CRYSOL)

Radius of gyration Rg (Guinier) rg_guinier	28.87 Å
Radius of gyration Rg (electron density) rg_electron	28.81 Å
Forward intensity I(0) i0	125021000.00
Molecular weight molecular_weight	80656.0 kDa
Excluded volume excluded_volume	97738 Å³
Envelope volume envelope_volume	131570 Å³
Hydration-shell volume shell_volume	38251 Å³
Envelope diameter envelope_diameter	106.9 Å
Shell Rg shell_rg	35.65 Å
Envelope Rg envelope_rg	29.33 Å
Shape Rg shape_rg	28.77 Å
Total Rg total_rg	29.51 Å
Total atoms total_atoms	5619
Residues n_residues	607
Spherical-harmonic order n_harmonics	20
q range q_range	— – 0.5000 Å⁻¹
Data points n_points	101
Shell type shell_type	directional
Solvent electron density solvent_density	0.3340 e/Å³
Shell contrast contrast_shell	0.0300 e/Å³
CRYSOL version crysol_version	4.1.3

▼

4. P(r) Distance Distribution (GNOM inversion) 4. P(r) Analysis (GNOM)

Maximum dimension Dmax dmax	102.8 Å
Rg (real space) rg_real	28.86 Å
Rg uncertainty (real space) rg_real_error	0.83 Å
I(0) (real space) i0_real	1.2500e+08
I(0) uncertainty (real space) i0_real_error	2.0400e+06
Rg (reciprocal space) rg_reciprocal	28.86 Å
I(0) (reciprocal space) i0_reciprocal	125000000.0000
Solution quality estimate total_estimate	0.6317
Solution quality rating solution_quality	REASONABLE a REASONABLE solution
P(r) peaks n_peaks	1
Primary peak position r_peak_primary	35.5 Å
Skewness Skewness skewness	0.423
Kurtosis Kurtosis kurtosis	0.014
Angular range angular_range	— – 0.2750 Å⁻¹
Current regularization parameter α current_alpha	0.0000
Highest regularization parameter α highest_alpha	20190000.0000
Real-space data points n_real_points	56
GNOM version gnom_version	4.1.3
Quality Criteria quality_criteria	AN1: 0.000; Oscil: 0.697; Stabil: 1.000; Sysdev: 0.062; Positv: 1.000; Valcen: 0.953; Smooth: 0.977

▶

5. Crystallography and Experiment 5. Crystallography & Experiment

▶

6. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Description description	5'-D(APAPAPAPAPGPAPCPTPT)-3'
Molecular weight formula_weight	3061.1 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	B
Atom count atom_count	5619

AAAAAGACTT

Entity 2 Entity 2 polymer

Description description	5'-D((TPC)PGPAPAPAPAPAPTPTPTPTPT)-3'
Molecular weight formula_weight	3676.5 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	C

CGAAAAATTTTT

Entity 3 Entity 3 polymer

Description description	5'-D(APAPAPAPAPTPTPTPTPTPCPGPAPAPGPTPCPTPTPTPTPT)-3'
Molecular weight formula_weight	6730.4 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	D

AAAAATTTTTCGAAGTCTTTTT

Entity 4 Entity 4 polymer

Description description	DNA topoisomerase I
Molecular weight formula_weight	70248.0 kDa
EC 编号 ec_number	5.99.1.2
Source method src_method	man
Copy count entity_count	1

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A

KKPKNKDKDKKVPEPDNKKKKPKKEEEQKWKWWEEERYPEGIKWKFLEHKGPVFAPPYEPLPENVKFYYDGKVMKLSPKAEEVATFFAKMLDHEYTTKEIFRKNFFKDWRKEMTNEEKNIITNLSKCDFTQMSQYFKAQTEARKQMSKEEKLKIKEENEKLLKEYGFCIMDNHKERIANFKIEPPGLFRGRGNHPKMGMLKRRIMPEDIIINCSKDAKVPSPPPGHKWKEVRHDNKVTWLVSWTENIQGSIKYIMLNPSSRIKGEKDWQKYETARRLKKCVDKIRNQYREDWKSKEMKVRQRAVALYFIDKLALRAGNEKEEGETADTVGCCSLRVEHINLHPELDGQEYVVEFDFLGKDSIRYYNKVPVEKRVFKNLQLFMENKQPEDDLFDRLNTGILNKHLQDLMEGLTAKVFRTYNASITLQQQLKELTAPDENIPAKILSYNRANRAVAILCNHQRAPPKTFEKSMMNLQTKIDAKKEQLADARRDLKSAKADAKVMKDAKTKKVVESKKKAVQRLEEQLMKLEVQATDREENKQIALGTSKLNYLDPRITVAWCKKWGVPIEKIYNKTQREKFAWAIDMADEDYEF

来源 Source

来源生物 organism	Homo sapiens
通用名 common_name	human
NCBI Class编号 ncbi_taxonomy_id	9606
宿主生物 host_organism	Spodoptera frugiperda

Entity 5 Entity 5 non-polymer

Description description	2,3-DIMETHOXY-12H-[1,3]DIOXOLO[5,6]INDENO[1,2-C]ISOQUINOLIN-6-IUM
Molecular weight formula_weight	322.3 kDa
Source method src_method	syn
Copy count entity_count	1

▼

7. Fold Classification (SCOP + CATH) 7 domains

SCOP 2.08 (3 domains)

Domain ID domain_id	d1tl8a1
Class class	a — All alpha proteins
Fold Fold fold	a.2 — Long alpha-hairpin
Superfamily Superfamily superfamily	a.2.8 — Eukaryotic DNA topoisomerase I, dispensable insert domain
Family Family family	a.2.8.1 — Eukaryotic DNA topoisomerase I, dispensable insert domain

Domain ID domain_id	d1tl8a2
Class class	d — Alpha and beta proteins (a+b)
Fold Fold fold	d.163 — DNA breaking-rejoining enzymes
Superfamily Superfamily superfamily	d.163.1 — DNA breaking-rejoining enzymes
Family Family family	d.163.1.2 — Eukaryotic DNA topoisomerase I, catalytic core

Domain ID domain_id	d1tl8a3
Class class	e — Multi-domain proteins (alpha and beta)
Fold Fold fold	e.15 — Eukaryotic DNA topoisomerase I, N-terminal DNA-binding fragment
Superfamily Superfamily superfamily	e.15.1 — Eukaryotic DNA topoisomerase I, N-terminal DNA-binding fragment
Family Family family	e.15.1.1 — Eukaryotic DNA topoisomerase I, N-terminal DNA-binding fragment

CATH v4.4 (4 domains)

Domain ID domain_id	1tl8A01
Class class	2 — Mainly Beta
Architecture architecture	170 — Beta Complex
Topology topology	11 — DNA Topoisomerase I; domain 2
Homologous superfamily homologous superfamily	10 — DNA Topoisomerase I, domain 2

Domain ID domain_id	1tl8A02
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	10 — Arc Repressor Mutant, subunit A
Homologous superfamily homologous superfamily	41 — Yeast DNA topoisomerase - domain 1

Domain ID domain_id	1tl8A03
Class class	3 — Alpha Beta
Architecture architecture	90 — Alpha-Beta Complex
Topology topology	15 — Topoisomerase I; Chain A, domain 3
Homologous superfamily homologous superfamily	10 — Topoisomerase I; Chain A, domain 3

Domain ID domain_id	1tl8A04
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	132 — Topoisomerase I; Chain A, domain 4
Homologous superfamily homologous superfamily	10 —

▶

8. Citations (1)

▶

Unit-cell length a length_a	56.949 Å
Unit-cell length b length_b	114.141 Å
Unit-cell length c length_c	73.499 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	94.18 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	2

Space group space_group	P 1 21 1
Space-group number int_tables_number	4
Crystal system crystal_system	—

Resolution resolution	3.100 Å
Low-resolution limit resolution_low	46.570 Å
R factor r_factor	—
R_work r_work	0.2290
R_free r_free	0.3050

fit	/app/data/saxs_computation/tl/1tl8/1tl8.fit
pddf	/app/data/pr_computation/tl/1tl8/1tl8.pr.out
profile	/app/data/saxs_computation/tl/1tl8/1tl8.dat

Human DNA topoisomerase I (70 kDa) in complex with the indenoisoquinoline AI-III-52 and covalent complex with a 22 base pair DNA duplex

1. Protein Identity and Related Structures Protein Identity & Related Structures

DNA topoisomerase I

State in the Current Structure

Other States of the Same Protein in the Database

SAXS scattering curve SAXS Profile

P(r) Distance Distribution P(r) Distribution

2. Structure Basics 2. Structure Basics

3. SAXS Parameters (CRYSOL theoretical calculation) 3. SAXS Parameters (CRYSOL)

4. P(r) Distance Distribution (GNOM inversion) 4. P(r) Analysis (GNOM)

5. Crystallography and Experiment 5. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

6. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Polymer Polymer

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 polymer

Polymer Polymer

Entity 4 Entity 4 polymer

Polymer Polymer

来源 Source

Entity 5 Entity 5 non-polymer

7. Fold Classification (SCOP + CATH) 7 domains

SCOP 2.08 (3 domains)

CATH v4.4 (4 domains)

8. Citations (1)

9. Files and Curves (10)

Files (7)

Curves (3)