1x9n

Crystal Structure of Human DNA Ligase I bound to 5'-adenylated, nicked DNA

Method: X-RAY DIFFRACTION D_max: 83.8 Å Quality: GOOD

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

DNA ligase I

Homo sapiens

State in the Current Structure

Assembly	Oligomeric State	Construct	Mutations and Modifications	Ligands, Ions and Associated Components	Method and Experimental Conditions	Structure Quality
1	Protein–DNA Monomer Protein × 1 DNA 3 PDB declaration: tetrameric（4） Consistent with all polymer counts	Chain A； UniProt 233–919	Non-standard monomer：Yes (specific site not provided by mmCIF)	dideoxy terminated DNA × 1 ;5'-phosphorylated DNA ; × 1 template DNA × 1 AMP ADENOSINE MONOPHOSPHATE × 1	X-RAY DIFFRACTION X-ray crystallization conditions：VAPOR DIFFUSION, SITTING DROP；pH 4.8；298 K；PEG 4000, sodium acetate, pH 4.8, VAPOR DIFFUSION, SITTING DROP, temperature 298.0K	Resolution 3.00 Å R-free 0.268

Other States of the Same Protein in the Database

Each row is a biological assembly of the same UniProt protein in another PDB entry. The “Difference from current entry” column identifies evidence-level differences; no tag means the currently parsed fields agree.

Other PDB	Difference from Current Entry 1X9N	Assembly / Oligomeric State	Construct	Mutations and Modifications	Ligands, Ions and Non-polymers	Method and Experimental Conditions	Structure Quality
6P09 Human DNA Ligase 1 Bound to an Adenylated, dideoxy Terminated DNA nick with 200 mM Mg2+ Deposited 2019-05-16	Different construct Different mutation/modification Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: tetrameric	Chain A 262–904（643 aa）	Not recorded	MG MAGNESIUM ION × 5 PEG DI(HYDROXYETHYL)ETHER × 1 AMP ADENOSINE MONOPHOSPHATE × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 6；293 K；100 mM MES, 100 mM Lithium Acetate, 15% (w/v) polyethylene glycol 3350	Resolution 2.05 Å R-free 0.201
6P0A Human DNA Ligase 1 Bound to an Adenylated, dideoxy Terminated DNA nick with 2 mM Mg2+ Deposited 2019-05-16	Different construct Different mutation/modification Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: tetrameric	Chain A 262–904（643 aa） Fragment：residues 262-904	Not recorded	MG MAGNESIUM ION × 1 AMP ADENOSINE MONOPHOSPHATE × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 6；293 K；100 mM MES, 100 mM Lithium Acetate, 15 % (w/v) PEG 3350	Resolution 2.05 Å R-free 0.203
6P0B Human DNA Ligase 1 (E346A/E592A) Bound to an Adenylated, dideoxy Terminated DNA nick with 200 mM Mg2+ Deposited 2019-05-16	Different construct Different mutation/modification Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: tetrameric	Chain A 262–904（643 aa） Fragment：residues 262-904	Mutation：E346A, E592A	MG MAGNESIUM ION × 4 PEG DI(HYDROXYETHYL)ETHER × 1 AMP ADENOSINE MONOPHOSPHATE × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 6；293 K；100 mM MES, 100 mM Lithium Acetate, 15% (w/v) PEG 3350	Resolution 2.20 Å R-free 0.206
6P0C Human DNA Ligase 1 Bound to an Adenylated, hydroxyl terminated DNA nick in EDTA Deposited 2019-05-16	Different construct Different mutation/modification Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: tetrameric	Chain A 262–904（643 aa） Fragment：residues 262-904	Not recorded	PEG DI(HYDROXYETHYL)ETHER × 1 AMP ADENOSINE MONOPHOSPHATE × 1 NA SODIUM ION × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 6；293 K；100 mM MES, 100 mM Lithium Acetate, 15% (w/v) PEG 3350	Resolution 1.55 Å R-free 0.165
6P0D Human DNA Ligase 1 (E346A/E592A) Bound to an Adenylated, hydroxyl terminated DNA nick Deposited 2019-05-16	Different construct Different mutation/modification Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: tetrameric	Chain A 262–904（643 aa）	Mutation：E346A, E592A	PEG DI(HYDROXYETHYL)ETHER × 1 AMP ADENOSINE MONOPHOSPHATE × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 6；293 K；100 mM MES, 100 mM Lithium Acetate, 15% (w/v) PEG 3350	Resolution 1.75 Å R-free 0.179
6P0E Human DNA Ligase 1 (E346A,E592A) bound to adenylated DNA containing an 8-oxo guanine:adenine base-pair Deposited 2019-05-16	Different construct Different mutation/modification Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: tetrameric	Chain A 262–904（643 aa） Fragment：residues 262-904	Mutation：E346A, E592A	PEG DI(HYDROXYETHYL)ETHER × 1 TRS 2-AMINO-2-HYDROXYMETHYL-PROPANE-1,3-DIOL × 2 AMP ADENOSINE MONOPHOSPHATE × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 6；293 K；100 mM MES, 100 mM Lithium Acetate, 15% (w/v) PEG 3350	Resolution 1.85 Å R-free 0.184
6Q1V Human DNA Ligase 1 (E592R) Bound to an Adenylated, hydroxyl terminated DNA nick Deposited 2019-08-06	Different construct Different mutation/modification Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: tetrameric	Chain A 262–904（643 aa）	Mutation：E592R	PEG DI(HYDROXYETHYL)ETHER × 1 ACT ACETATE ION × 1 AMP ADENOSINE MONOPHOSPHATE × 1 TRS 2-AMINO-2-HYDROXYMETHYL-PROPANE-1,3-DIOL × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION；277 K；100 mM MES, 100 mM Lithium Acetate, 15% (w/v) PEG 3350	Resolution 1.85 Å R-free 0.194
7KR3 Human DNA Ligase 1(E346A/E592A) Bound to a bulged DNA substrate Deposited 2020-11-18	Different construct Different mutation/modification Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: tetrameric	Chain A 262–904（643 aa）	Mutation：E346A, E592A	AMP ADENOSINE MONOPHOSPHATE × 1 ACT ACETATE ION × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 6；293 K；100 mM MES, 150 mM lithium acetate, 10% (w/v) polyethylene glycol 3350	Resolution 2.78 Å R-free 0.239
7KR4 Human DNA Ligase 1(E346A/E592A) Bound to a nicked DNA substrate control duplex Deposited 2020-11-18	Different construct Different mutation/modification Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: tetrameric	Chain A 262–904（643 aa）	Mutation：E346A, E592A	ACT ACETATE ION × 4 AMP ADENOSINE MONOPHOSPHATE × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 6；293 K；100 mM MES, 100 mM lithium acetate, 12% (w/v) polyethylene glycol 3350	Resolution 2.20 Å R-free 0.215
7L34 Human DNA Ligase 1 - R641L nicked DNA complex Deposited 2020-12-17	Different construct Different mutation/modification Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: tetrameric	Chain A 262–906（645 aa）	Mutation：R641L	AMP ADENOSINE MONOPHOSPHATE × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 6；293 K；100 mM MES, pH 6, 100 mM lithium acetate, 15% (w/v) polyethylene glycol PEG3350	Resolution 1.90 Å R-free 0.193
7L35 Human DNA Ligase 1 - R771W nicked DNA complex Deposited 2020-12-17	Different construct Different mutation/modification Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: tetrameric	Chain A 262–906（645 aa）	Mutation：R771W	PEG DI(HYDROXYETHYL)ETHER × 1 NA SODIUM ION × 1 AMP ADENOSINE MONOPHOSPHATE × 1 TRS 2-AMINO-2-HYDROXYMETHYL-PROPANE-1,3-DIOL × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 6；293 K；100 mM MES, pH 6, 100 mM lithium acetate, 15% (w/v) polyethylene glycol PEG3350	Resolution 2.00 Å R-free 0.195
7QNZ human Lig1-DNA-PCNA complex reconstituted in absence of ATP Deposited 2021-12-23	Different construct Different mutation/modification Different oligomeric state Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Heteromer；Protein × 4 PDB declaration: heptameric	Chain A 1–919（919 aa）	Not recorded	AMP ADENOSINE MONOPHOSPHATE × 1	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 4.58 Å
7QO1 complex of DNA ligase I and FEN1 on PCNA and DNA Deposited 2021-12-23	Different construct Different mutation/modification Different oligomeric state Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Heteromer；Protein × 5 PDB declaration: octameric	Chain A 161–919（759 aa）	Not recorded	AMP ADENOSINE MONOPHOSPHATE × 1	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 4.40 Å
7SUM Crystal structure of human ligase I with nick duplexes containing cognate A:T Deposited 2021-11-17	Different construct Different mutation/modification Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: tetrameric	Chain A 261–918（658 aa） Fragment：UNP residues 261-918	Not recorded	AMP ADENOSINE MONOPHOSPHATE × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；293 K；100 mM MES, pH 6.6, 100 mM lithium acetate, 20% w/v PEG3350	Resolution 2.90 Å R-free 0.227
7SX5 Crystal structure of ligase I with nick duplexes containing mismatch A:C Deposited 2021-11-22	Different construct Different mutation/modification Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: tetrameric	Chain A 261–918（658 aa） Fragment：UNP residues 261-918	Not recorded	AMP ADENOSINE MONOPHOSPHATE × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 6.6；293 K；100 mM MES pH 6.6, 100 mM lithium acetate, 20% (w/v) polyethylene glycol PEG3350	Resolution 2.80 Å R-free 0.212
7SXE Crystal structure of ligase I with nick duplexes containing cognate G:T Deposited 2021-11-22	Different construct Different mutation/modification Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: tetrameric	Chain A 261–918（658 aa） Fragment：UNP residues 261-918	Not recorded	AMP ADENOSINE MONOPHOSPHATE × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；293 K；100 mM MES, pH 6.6, 100 mM lithium acetate, 20% w/v PEG3350	Resolution 3.00 Å R-free 0.245
8B8T Open conformation of the complex of DNA ligase I on PCNA and DNA in the presence of ATP Deposited 2022-10-05	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein heterocomplex Heteromer；Protein × 4 PDB declaration: tetrameric	Chain A 262–535（274 aa）	Not recorded	No recorded non-water small molecule	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 4.20 Å
8V1U Human DNA Ligase I F872A bound to adenylated nicked DNA with a 5' terminal ribonucleotide Deposited 2023-11-21	Different construct Different mutation/modification Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: tetrameric	Chain A 262–904（643 aa）	Mutation：F872A	PEG DI(HYDROXYETHYL)ETHER × 1 MES 2-(N-MORPHOLINO)-ETHANESULFONIC ACID × 2 CL CHLORIDE ION × 1 GOL GLYCEROL × 1 NA SODIUM ION × 2 AMP ADENOSINE MONOPHOSPHATE × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 5.5；293 K；MES pH5.5 100mM, Lithium acetate 500mM, PEG 3350 10%	Resolution 2.00 Å R-free 0.210
8V1V Human DNA Ligase I F872L bound to adenylated nicked DNA Deposited 2023-11-21	Different construct Different mutation/modification Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: tetrameric	Chain A 262–904（643 aa）	Mutation：F872L	GOL GLYCEROL × 3 MES 2-(N-MORPHOLINO)-ETHANESULFONIC ACID × 2 AMP ADENOSINE MONOPHOSPHATE × 1 NA SODIUM ION × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 5.5；293 K；MES pH5.5 100mM, Lithium acetate 500mM, PEG 3350 10%	Resolution 2.30 Å R-free 0.223
8V1W Human DNA Ligase I F872A bound to adenylated nicked DNA Deposited 2023-11-21	Different construct Different mutation/modification Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: tetrameric	Chain A 262–904（643 aa）	Mutation：F872A	MES 2-(N-MORPHOLINO)-ETHANESULFONIC ACID × 2 AMP ADENOSINE MONOPHOSPHATE × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 5.5；293 K；MES pH5.5 100mM, Lithium acetate 500mM, PEG 3350 10%	Resolution 2.20 Å R-free 0.218
8VDN DNA Ligase 1 with nick dG:C Deposited 2023-12-16	Different construct Different mutation/modification Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: tetrameric	Chain A 261–918（658 aa） Fragment：UNP residues 261-918	Mutation：E346A, E592A	AMP ADENOSINE MONOPHOSPHATE × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；298.15 K；100 mM MES, pH 6.4, 100 mM Lithium acetate, 12% w/v PEG 3350	Resolution 2.39 Å R-free 0.241
8VDS DNA Ligase 1 with nick DNA 3'rG:C Deposited 2023-12-17	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: trimeric	Chain A 261–918（658 aa）	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 6.4；298.15 K；100 mM MES, pH 6.4, 100 mM Lithium acetate, 12% PEG3350	Resolution 2.79 Å R-free 0.252
8VDT DNA Ligase 1 with nick DNA 3'rA:T Deposited 2023-12-17	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: trimeric	Chain A 261–918（658 aa） Fragment：UNP residues 261-918	Not recorded	PO4 PHOSPHATE ION × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 6.4；298.5 K；100mM MES, pH 6.4, 100mM Lithium Acetate, 12 w/vPEG 3350	Resolution 2.78 Å R-free 0.249
8VZL DNA Ligase 1 captured with pre-step 3 ligation at the rG:C nicksite Deposited 2024-02-11	Different construct Different mutation/modification Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: tetrameric	Chain A 261–918（658 aa）	Not recorded	AMP ADENOSINE MONOPHOSPHATE × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；298.1 K；100 mM MES (pH 7.0), 100 mM lithium acetate, 14% (w/v) PEG3350	Resolution 2.41 Å R-free 0.219
8VZM DNA Ligase 1 captured with pre-step 3 ligation at the rA:T nicksite Deposited 2024-02-11	Different construct Different mutation/modification Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: tetrameric	Chain A 261–918（658 aa）	Not recorded	AMP ADENOSINE MONOPHOSPHATE × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 6.7；298.1 K；100 mM MES (pH 6.7), 100 mM lithium acetate, 16% (w/v) PEG3350	Resolution 2.51 Å R-free 0.233
9BS3 Wild type DNA Ligase 1 with 5'-rG:C Deposited 2024-05-12	Different construct Different mutation/modification Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: tetrameric	Chain A 261–904（644 aa）	Not recorded	AMP ADENOSINE MONOPHOSPHATE × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION；298.15 K；100mM MES pH 5.3, 18% PEG3350, 100mM Lithium Acetate.	Resolution 2.69 Å R-free 0.249
9BS3 Wild type DNA Ligase 1 with 5'-rG:C Deposited 2024-05-12	Different construct Different mutation/modification Different experimental conditions Different structure-quality metrics	Assembly 2 Protein–DNA Monomer；Protein × 1 PDB declaration: tetrameric	Chain E 261–904（644 aa）	Not recorded	AMP ADENOSINE MONOPHOSPHATE × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION；298.15 K；100mM MES pH 5.3, 18% PEG3350, 100mM Lithium Acetate.	Resolution 2.69 Å R-free 0.249
9BS4 DNA Ligase 1 E346A/E592A double mutant with 5'-rG:C Deposited 2024-05-12	Different construct Different mutation/modification Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: tetrameric	Chain A 261–904（644 aa）	Mutation：E346A, E592A	AMP ADENOSINE MONOPHOSPHATE × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 5.3；298.5 K；100mM MES pH 5.3, 18% PEG3350, 100mM Lithium acetate	Resolution 2.40 Å R-free 0.237
9BS4 DNA Ligase 1 E346A/E592A double mutant with 5'-rG:C Deposited 2024-05-12	Different construct Different mutation/modification Different experimental conditions Different structure-quality metrics	Assembly 2 Protein–DNA Monomer；Protein × 1 PDB declaration: tetrameric	Chain E 261–904（644 aa）	Mutation：E346A, E592A	AMP ADENOSINE MONOPHOSPHATE × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 5.3；298.5 K；100mM MES pH 5.3, 18% PEG3350, 100mM Lithium acetate	Resolution 2.40 Å R-free 0.237
9NYS Human DNA Ligase 1 E346A/E592A/K845N triple mutant with 3'-A:T nick Deposited 2025-03-28	Different construct Different mutation/modification Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: tetrameric	Chain A 262–918（657 aa）	Mutation：E346A, E592A, K845N	DMS DIMETHYL SULFOXIDE × 4 AMP ADENOSINE MONOPHOSPHATE × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 7；298 K；100mM MES pH 7.0, 100 mM Litium Acetate, 20% (w/v) PEG 3350	Resolution 2.64 Å R-free 0.223
9YHU DNA ligase 1 E346A/E592A in complex with nick containing 3'-8oxorG:A captured at post-catalytic stage Deposited 2025-10-01	Different construct Different mutation/modification Different oligomeric state Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: trimeric	Chain A 262–918（657 aa）	Mutation：E346A, E592A	AMP ADENOSINE MONOPHOSPHATE × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 6.5；296 K；100 mM MES (pH 6.5), 200 mM Lithium acetate, 12% (w/v) PEG3350	Resolution 1.96 Å R-free 0.203
9YHV DNA ligase 1 E346A/E592A in complex with nick containing 3'-8oxorG:C captured at pre-catalytic stage Deposited 2025-10-01	Different construct Different mutation/modification Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: tetrameric	Chain A 262–918（657 aa）	Mutation：E346A, E592A	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 6；296 K；100 mM MES (pH 6.0), 150 mM Lithium acetate, 16% (w/v) PEG3350	Resolution 2.81 Å R-free 0.262
9YHW DNA ligase 1 E346A/E592A in complex with nick containing 3'-8oxodG:A captured at pre-catalytic stage Deposited 2025-10-01	Different construct Different mutation/modification Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: tetrameric	Chain A 262–918（657 aa）	Mutation：E346A, E592A	DMS DIMETHYL SULFOXIDE × 5	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 6.5；296 K；100 mM MES (pH 6.5), 100 mM Lithium acetate, 12% (w/v) PEG3350	Resolution 2.56 Å R-free 0.229
9YHX DNA ligase 1 E346A/E592A in complex with nick containing 3'-8oxodG:C captured at pre-catalytic stage Deposited 2025-10-01	Different construct Different mutation/modification Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: tetrameric	Chain A 262–918（657 aa）	Mutation：E346A, E592A	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 6.2；296 K；100 mM MES(pH 6.2), 200 mM Lithium acetate, 16% (w/v) PEG3350	Resolution 2.96 Å R-free 0.253
9YHY DNA ligase 1 wild-type in complex with nick containing 3'-8oxodG:C captured at pre-catalytic stage Deposited 2025-10-01	Different construct Different mutation/modification Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: tetrameric	Chain A 262–918（657 aa）	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 6.2；296 K；100 mM MES(pH 6.2), 200 mM Lithium acetate, 16% (w/v) PEG3350	Resolution 2.76 Å R-free 0.283

33 other PDB entries and 35 assemblies. Open the comparison page and filter oligomeric states

View Construct and Data Evidence

UniProt name	DNL1_HUMAN
Isoform	—
PDB entities	4
Chains and sequence ranges	Author chain A； PDBConstruct 2–688； UniProt 233–919

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

SAXS scattering curve SAXS Profile

P(r) Distance Distribution P(r) Distribution

Download Download SAXS (.dat) P(r) (.pr.out) CIF

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	1x9n
Deposition date deposition_date	2004-08-23
Structure title title	Crystal Structure of Human DNA Ligase I bound to 5'-adenylated, nicked DNA
Keywords keywords	;DNA ligase, 5'-adenylated nicked DNA, protein-DNA complex, Ligase-DNA COMPLEX ;; Ligase/DNA
Experimental Method method	X-RAY DIFFRACTION

▼

3. SAXS Parameters (CRYSOL theoretical calculation) 3. SAXS Parameters (CRYSOL)

Radius of gyration Rg (Guinier) rg_guinier	26.89 Å
Radius of gyration Rg (electron density) rg_electron	26.33 Å
Forward intensity I(0) i0	130815000.00
Molecular weight molecular_weight	82347.0 kDa
Excluded volume excluded_volume	99706 Å³
Envelope volume envelope_volume	122570 Å³
Hydration-shell volume shell_volume	37644 Å³
Envelope diameter envelope_diameter	87.6 Å
Shell Rg shell_rg	34.76 Å
Envelope Rg envelope_rg	26.18 Å
Shape Rg shape_rg	26.34 Å
Total Rg total_rg	27.08 Å
Total atoms total_atoms	5730
Residues n_residues	665
Spherical-harmonic order n_harmonics	20
q range q_range	— – 0.5000 Å⁻¹
Data points n_points	101
Shell type shell_type	directional
Solvent electron density solvent_density	0.3340 e/Å³
Shell contrast contrast_shell	0.0300 e/Å³
CRYSOL version crysol_version	4.1.3

▼

4. P(r) Distance Distribution (GNOM inversion) 4. P(r) Analysis (GNOM)

Maximum dimension Dmax dmax	83.8 Å
Rg (real space) rg_real	26.71 Å
Rg uncertainty (real space) rg_real_error	0.49 Å
I(0) (real space) i0_real	1.3080e+08
I(0) uncertainty (real space) i0_real_error	1.8010e+06
Rg (reciprocal space) rg_reciprocal	26.77 Å
I(0) (reciprocal space) i0_reciprocal	130800000.0000
Solution quality estimate total_estimate	0.8229
Solution quality rating solution_quality	GOOD a GOOD solution
P(r) peaks n_peaks	2
Primary peak position r_peak_primary	34.1 Å
Skewness Skewness skewness	0.142
Kurtosis Kurtosis kurtosis	-0.456
Angular range angular_range	— – 0.2950 Å⁻¹
Current regularization parameter α current_alpha	0.0000
Highest regularization parameter α highest_alpha	21190000.0000
Real-space data points n_real_points	60
GNOM version gnom_version	4.1.3
Quality Criteria quality_criteria	AN1: 0.000; Oscil: 0.902; Stabil: 1.000; Sysdev: 1.000; Positv: 1.000; Valcen: 0.990; Smooth: 0.000

▶

5. Crystallography and Experiment 5. Crystallography & Experiment

▶

6. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Description description	dideoxy terminated DNA
Molecular weight formula_weight	3982.6 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	B
Atom count atom_count	5730

GTGCTGATGCGTC

Entity 2 Entity 2 polymer

Description description	;5'-phosphorylated DNA ;
Molecular weight formula_weight	4641.0 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	C

GTCGGACTGATTCGG

Entity 3 Entity 3 polymer

Description description	template DNA
Molecular weight formula_weight	8529.5 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	D

CCGAATCAGTCCGACGACGCATCAGCAC

Entity 4 Entity 4 polymer

Description description	DNA ligase I
Molecular weight formula_weight	76609.3 kDa
EC 编号 ec_number	6.5.1.1
Source method src_method	man
Copy count entity_count	1

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A

MTPRKPAVKKEVKEEEPGAPGKEGAAEGPLDPSGYNPAKNNYHPVEDACWKPGQKVPYLAVARTFEKIEEVSARLRMVETLSNLLRSVVALSPPDLLPVLYLSLNHLGPPQQGLELGVGDGVLLKAVAQATGRQLESVRAEAAEKGDVGLVAENSRSTQRLMLPPPPLTASGVFSKFRDIARLTGSASTAKKIDIIKGLFVACRHSEARFIARSLSGRLRLGLAEQSVLAALSQAVSLTPPGQEFPPAMVDAGKGKTAEARKTWLEEQGMILKQTFCEVPDLDRIIPVLLEHGLERLPEHCKLSPGIPLKPMLAHPTRGISEVLKRFEEAAFTCEYKYDGQRAQIHALEGGEVKIFSRNQEDNTGKYPDIISRIPKIKLPSVTSFILDTEAVAWDREKKQIQPFQVLTTRKRKEVDASEIQVQVCLYAFDLIYLNGESLVREPLSRRRQLLRENFVETEGEFVFATSLDTKDIEQIAEFLEQSVKDSCEGLMVKTLDVDATYEIAKRSHNWLKLKKDYLDGVGDTLDLVVIGAYLGRGKRAGRYGGFLLASYDEDSEELQAICKLGTGFSDEELEEHHQSLKALVLPSPRPYVRIDGAVIPDHWLDPSAVWEVKCADLSLSPIYPAARGLVDSDKGISLRFPRFIRVREDKQPEQATTSAQVACLYRKQSQIQNQQGEDSGSDPEDTY

来源 Source

来源生物 organism	Homo sapiens
通用名 common_name	human
NCBI Class编号 ncbi_taxonomy_id	9606
宿主生物 host_organism	Escherichia coli

Entity 5 Entity 5 non-polymer

Description description	ADENOSINE MONOPHOSPHATE
Molecular weight formula_weight	347.2 kDa
Source method src_method	syn
Copy count entity_count	1

▼

7. Fold Classification (SCOP + CATH) 7 domains

SCOP 2.08 (3 domains)

Domain ID domain_id	d1x9na1
Class class	a — All alpha proteins
Fold Fold fold	a.235 — ATP-dependent DNA ligase DNA-binding domain
Superfamily Superfamily superfamily	a.235.1 — ATP-dependent DNA ligase DNA-binding domain
Family Family family	a.235.1.1 — ATP-dependent DNA ligase DNA-binding domain

Domain ID domain_id	d1x9na2
Class class	b — All beta proteins
Fold Fold fold	b.40 — OB-fold
Superfamily Superfamily superfamily	b.40.4 — Nucleic acid-binding proteins
Family Family family	b.40.4.6 — DNA ligase/mRNA capping enzyme postcatalytic domain

Domain ID domain_id	d1x9na3
Class class	d — Alpha and beta proteins (a+b)
Fold Fold fold	d.142 — ATP-grasp
Superfamily Superfamily superfamily	d.142.2 — DNA ligase/mRNA capping enzyme, catalytic domain
Family Family family	d.142.2.1 — ATP-dependent DNA ligase catalytic domain

CATH v4.4 (4 domains)

Domain ID domain_id	1x9nA01
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	3260 — DNA ligase i, domain 1
Homologous superfamily homologous superfamily	10 — DNA ligase, ATP-dependent, N-terminal domain

Domain ID domain_id	1x9nA02
Class class	3 — Alpha Beta
Architecture architecture	30 — 2-Layer Sandwich
Topology topology	1490 — Dna Ligase; domain 1
Homologous superfamily homologous superfamily	70 —

Domain ID domain_id	1x9nA03
Class class	3 — Alpha Beta
Architecture architecture	30 — 2-Layer Sandwich
Topology topology	470 — D-amino Acid Aminotransferase; Chain A, domain 1
Homologous superfamily homologous superfamily	30 — DNA ligase/mRNA capping enzyme

Domain ID domain_id	1x9nA04
Class class	2 — Mainly Beta
Architecture architecture	40 — Beta Barrel
Topology topology	50 — OB fold (Dihydrolipoamide Acetyltransferase, E2P)
Homologous superfamily homologous superfamily	140 — Nucleic acid-binding proteins

▶

8. Citations (1)

▶

Unit-cell length a length_a	161.889 Å
Unit-cell length b length_b	161.889 Å
Unit-cell length c length_c	88.455 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	90.00 °
Unit-cell angle γ angle_gamma	120.00 °
Molecules per unit cell Z z_pdb	6

Space group space_group	P 63
Space-group number int_tables_number	173
Crystal system crystal_system	—

Resolution resolution	3.000 Å
Low-resolution limit resolution_low	20.000 Å
R factor r_factor	0.2363
R_work r_work	0.2346
R_free r_free	0.2683

fit	/app/data/saxs_computation/x9/1x9n/1x9n.fit
pddf	/app/data/pr_computation/x9/1x9n/1x9n.pr.out
profile	/app/data/saxs_computation/x9/1x9n/1x9n.dat

Crystal Structure of Human DNA Ligase I bound to 5'-adenylated, nicked DNA

1. Protein Identity and Related Structures Protein Identity & Related Structures

DNA ligase I

State in the Current Structure

Other States of the Same Protein in the Database

SAXS scattering curve SAXS Profile

P(r) Distance Distribution P(r) Distribution

2. Structure Basics 2. Structure Basics

3. SAXS Parameters (CRYSOL theoretical calculation) 3. SAXS Parameters (CRYSOL)

4. P(r) Distance Distribution (GNOM inversion) 4. P(r) Analysis (GNOM)

5. Crystallography and Experiment 5. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

6. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Polymer Polymer

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 polymer

Polymer Polymer

Entity 4 Entity 4 polymer

Polymer Polymer

来源 Source

Entity 5 Entity 5 non-polymer

7. Fold Classification (SCOP + CATH) 7 domains

SCOP 2.08 (3 domains)

CATH v4.4 (4 domains)

8. Citations (1)

9. Files and Curves (10)

Files (7)

Curves (3)