SAXSdb — 1x9n

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

DNA ligase I

Homo sapiens

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–DNA	Monomer	Protein 1 DNA 3	dideoxy terminated DNA × 1 ;5'-phosphorylated DNA ; × 1 template DNA × 1 ADENOSINE MONOPHOSPHATE × 1	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	DNL1_HUMAN
Isoform	—
PDB entities	4
Chains and sequence ranges	Author chain A； PDBConstruct 2–688； UniProt 233–919

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	1x9n
Deposition date deposition_date	2004-08-23
Structure title title	Crystal Structure of Human DNA Ligase I bound to 5'-adenylated, nicked DNA
Keywords keywords	;DNA ligase, 5'-adenylated nicked DNA, protein-DNA complex, Ligase-DNA COMPLEX ;; Ligase/DNA
Experimental Method method	X-RAY DIFFRACTION

▼

3. Official assembly/model SAXS Official SAXS Profiles

This page reads only the latest assembly calculations. Every curve maps to an explicit PDB entry, official biological assembly and coordinate model.

1x9n__assembly_1__model_1

Assembly 1 · Model 1 · CRYSOL 4.1.3-1-20251215 (887e7ef)

Download this curve (.dat)

1x9n__assembly_1__model_1 | I(q)

100 plotted points; both axes use logarithmic scales.

1x9n__assembly_1__model_1 | P(r) · Pending

P(r) will be calculated and displayed separately for the same assembly/model.

Rg（Guinier）	26.89 Å
Rg (electron density)	26.33 Å
Total Rg	27.08 Å
Atom count	5730
Residues	665
Excluded volume	99706 Å³
Maximum q	0.500 Å⁻¹

Assembly	Model	Structure unit	Oligomeric description	Status	CRYSOL	Actions
1	1	`1x9n__assembly_1__model_1`	tetrameric （4）	Success	4.1.3-1-20251215 (887e7ef)	View Download

▶

4. Crystallography and Experiment 4. Crystallography & Experiment

▶

5. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Description description	dideoxy terminated DNA
Molecular weight formula_weight	3982.6 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	B
Atom count atom_count	5730

GTGCTGATGCGTC

Entity 2 Entity 2 polymer

Description description	;5'-phosphorylated DNA ;
Molecular weight formula_weight	4641.0 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	C

GTCGGACTGATTCGG

Entity 3 Entity 3 polymer

Description description	template DNA
Molecular weight formula_weight	8529.5 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	D

CCGAATCAGTCCGACGACGCATCAGCAC

Entity 4 Entity 4 polymer

Description description	DNA ligase I
Molecular weight formula_weight	76609.3 kDa
EC 编号 ec_number	6.5.1.1
Source method src_method	man
Copy count entity_count	1

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A

MTPRKPAVKKEVKEEEPGAPGKEGAAEGPLDPSGYNPAKNNYHPVEDACWKPGQKVPYLAVARTFEKIEEVSARLRMVETLSNLLRSVVALSPPDLLPVLYLSLNHLGPPQQGLELGVGDGVLLKAVAQATGRQLESVRAEAAEKGDVGLVAENSRSTQRLMLPPPPLTASGVFSKFRDIARLTGSASTAKKIDIIKGLFVACRHSEARFIARSLSGRLRLGLAEQSVLAALSQAVSLTPPGQEFPPAMVDAGKGKTAEARKTWLEEQGMILKQTFCEVPDLDRIIPVLLEHGLERLPEHCKLSPGIPLKPMLAHPTRGISEVLKRFEEAAFTCEYKYDGQRAQIHALEGGEVKIFSRNQEDNTGKYPDIISRIPKIKLPSVTSFILDTEAVAWDREKKQIQPFQVLTTRKRKEVDASEIQVQVCLYAFDLIYLNGESLVREPLSRRRQLLRENFVETEGEFVFATSLDTKDIEQIAEFLEQSVKDSCEGLMVKTLDVDATYEIAKRSHNWLKLKKDYLDGVGDTLDLVVIGAYLGRGKRAGRYGGFLLASYDEDSEELQAICKLGTGFSDEELEEHHQSLKALVLPSPRPYVRIDGAVIPDHWLDPSAVWEVKCADLSLSPIYPAARGLVDSDKGISLRFPRFIRVREDKQPEQATTSAQVACLYRKQSQIQNQQGEDSGSDPEDTY

Source Source

Source organism organism	Homo sapiens
Common name common_name	human
NCBI taxonomy ID ncbi_taxonomy_id	9606
Host organism host_organism	Escherichia coli

Entity 5 Entity 5 non-polymer

Description description	ADENOSINE MONOPHOSPHATE
Molecular weight formula_weight	347.2 kDa
Source method src_method	syn
Copy count entity_count	1

▼

6. Fold Classification (SCOP + CATH) 7 domains

SCOP 2.08 (3 domains)

Domain ID domain_id	d1x9na1
Class class	a — All alpha proteins
Fold Fold fold	a.235 — ATP-dependent DNA ligase DNA-binding domain
Superfamily Superfamily superfamily	a.235.1 — ATP-dependent DNA ligase DNA-binding domain
Family Family family	a.235.1.1 — ATP-dependent DNA ligase DNA-binding domain

Domain ID domain_id	d1x9na2
Class class	b — All beta proteins
Fold Fold fold	b.40 — OB-fold
Superfamily Superfamily superfamily	b.40.4 — Nucleic acid-binding proteins
Family Family family	b.40.4.6 — DNA ligase/mRNA capping enzyme postcatalytic domain

Domain ID domain_id	d1x9na3
Class class	d — Alpha and beta proteins (a+b)
Fold Fold fold	d.142 — ATP-grasp
Superfamily Superfamily superfamily	d.142.2 — DNA ligase/mRNA capping enzyme, catalytic domain
Family Family family	d.142.2.1 — ATP-dependent DNA ligase catalytic domain

CATH v4.4 (4 domains)

Domain ID domain_id	1x9nA01
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	3260 — DNA ligase i, domain 1
Homologous superfamily homologous superfamily	10 — DNA ligase, ATP-dependent, N-terminal domain

Domain ID domain_id	1x9nA02
Class class	3 — Alpha Beta
Architecture architecture	30 — 2-Layer Sandwich
Topology topology	1490 — Dna Ligase; domain 1
Homologous superfamily homologous superfamily	70 —

Domain ID domain_id	1x9nA03
Class class	3 — Alpha Beta
Architecture architecture	30 — 2-Layer Sandwich
Topology topology	470 — D-amino Acid Aminotransferase; Chain A, domain 1
Homologous superfamily homologous superfamily	30 — DNA ligase/mRNA capping enzyme

Domain ID domain_id	1x9nA04
Class class	2 — Mainly Beta
Architecture architecture	40 — Beta Barrel
Topology topology	50 — OB fold (Dihydrolipoamide Acetyltransferase, E2P)
Homologous superfamily homologous superfamily	140 — Nucleic acid-binding proteins

▶

Unit-cell length a length_a	161.889 Å
Unit-cell length b length_b	161.889 Å
Unit-cell length c length_c	88.455 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	90.00 °
Unit-cell angle γ angle_gamma	120.00 °
Molecules per unit cell Z z_pdb	6

Space group space_group	P 63
Space-group number int_tables_number	173
Crystal system crystal_system	—

Resolution resolution	3.000 Å
Low-resolution limit resolution_low	20.000 Å
R factor r_factor	0.2363
R_work r_work	0.2346
R_free r_free	0.2683

Crystal Structure of Human DNA Ligase I bound to 5'-adenylated, nicked DNA

1. Protein Identity and Related Structures Protein Identity & Related Structures

DNA ligase I

State in the Current Structure

Other States of the Same Protein in the Database

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

1x9n__assembly_1__model_1

1x9n__assembly_1__model_1 | I(q)

1x9n__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

5. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Polymer Polymer

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 polymer

Polymer Polymer

Entity 4 Entity 4 polymer

Polymer Polymer

Source Source

Entity 5 Entity 5 non-polymer

6. Fold Classification (SCOP + CATH) 7 domains

SCOP 2.08 (3 domains)

CATH v4.4 (4 domains)

7. Citations (1)

Crystal Structure of Human DNA Ligase I bound to 5'-adenylated, nicked DNA

1. Protein Identity and Related Structures Protein Identity & Related Structures

DNA ligase I

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

1x9n__assembly_1__model_1

1x9n__assembly_1__model_1 | I(q)

1x9n__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

5. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Polymer Polymer

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 polymer

Polymer Polymer

Entity 4 Entity 4 polymer

Polymer Polymer

Source Source

Entity 5 Entity 5 non-polymer

6. Fold Classification (SCOP + CATH) 7 domains

SCOP 2.08 (3 domains)

CATH v4.4 (4 domains)

7. Citations (1)